Rh7DG406300

Pentatricopeptide repeat-containing protein At5g61990

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0001276
Physical Location & Seq
Reverse (-)
56750056 .. 56750400
345 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG406300.1

Sequence Viewer

Length: 345 bp
ATGGTTGATGGATTGTGTAGAAGTAGGGCTGTTGATGAAGCCATTGAGTTGAAAAAATCGATGGTTGAGAAGGGATTGACACCTGATAGGTATACATATTCAGTACTAATTGATGGATTGTGCAGACAGAAGAGATCAGAAGAAGCAAAATTGGTATTGAACGAGATGTATGATATAGGTTTGAATCCTGACTGCACCATGTACATTGCTTTGATTGATGGATTCTTGAAAGAAAATAACGTGGATAAGGCCCTCAGGATCAAAGAAGAGATGGTCGCTCGAGGAGTTAAGTTGTGCGGTGTCACATATAATGTGATTTTTGCAGGGATCTGTAAAATAGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00260 ko00261 ko00270 ko00300 ko01100 ko01110 ko01120 ko01130 ko01210 ko01230 map00260 map00261 map00270 map00300 map01100 map01110 map01120 map01130 map01210 map01230
Pfam Domains
Protein Families
Mem_trans PPR PPR_1 PPR_2 PPR_3 PPR_long

Protein Analysis

114

Amino Acids

12.78

Weight (kDa)

6.29

Isoelectric Point (pI)

29.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_2 PF13041 1 - 42 6.1e-14 PPR repeat family
PPR_long PF17177 9 - 101 3.1e-08 Pentacotripeptide-repeat region of PRORP
PPR_1 PF12854 24 - 56 1e-10 PPR repeat
PPR PF01535 31 - 60 1.6e-06 PPR repeat
PPR_3 PF13812 52 - 107 3.5e-07 Pentatricopeptide repeat domain
PPR_1 PF12854 60 - 92 3.3e-06 PPR repeat
PPR_2 PF13041 63 - 112 7.7e-11 PPR repeat family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 92
AciI CCGC 1 cut(s) 297
AclWI GGATC 2 cut(s) 266, 335
AfaI GTAC 2 cut(s) 105, 203
AgsI TTSAA 4 cut(s) 52, 160, 184, 229
AlwI GGATC 2 cut(s) 266, 335
Ama87I CYCGRG 1 cut(s) 279
AoxI GGCC 1 cut(s) 249
AspS9I GGNCC 1 cut(s) 250
AvaI CYCGRG 1 cut(s) 279
AxyI CCTNAGG 1 cut(s) 254
BccI CCATC 5 cut(s) 2, 55, 107, 212, 265
BmcAI AGTACT 1 cut(s) 105
BmeT110I CYCGRG 1 cut(s) 279
BmgT120I GGNCC 1 cut(s) 250
Bsa29I ATCGAT 1 cut(s) 59
Bse21I CCTNAGG 1 cut(s) 254
Bse3DI GCAATG 1 cut(s) 204
BseCI ATCGAT 1 cut(s) 59
BseMI GCAATG 1 cut(s) 204
BseMII CTCAG 1 cut(s) 268
BseRI GAGGAG 1 cut(s) 297
BsgI GTGCAG 2 cut(s) 142, 178
BshFI GGCC 1 cut(s) 251
BshVI ATCGAT 1 cut(s) 59
BsiHKCI CYCGRG 1 cut(s) 279
BsnI GGCC 1 cut(s) 251
BsoBI CYCGRG 1 cut(s) 279
Bsp1407I TGTACA 1 cut(s) 201
Bsp143I GATC 3 cut(s) 134, 258, 327
BspACI CCGC 1 cut(s) 297
BspANI GGCC 1 cut(s) 251
BspCNI CTCAG 1 cut(s) 267
BspDI ATCGAT 1 cut(s) 59
BspPI GGATC 2 cut(s) 266, 335
BsrDI GCAATG 1 cut(s) 204
BsrGI TGTACA 1 cut(s) 201
BssMI GATC 3 cut(s) 134, 258, 327
BssNAI GTATAC 1 cut(s) 93
Bst1107I GTATAC 1 cut(s) 93
Bst6I CTCTTC 2 cut(s) 125, 261
BstAUI TGTACA 1 cut(s) 201
BstDEI CTNAG 1 cut(s) 254
BstKTI GATC 3 cut(s) 137, 261, 330
BstMBI GATC 3 cut(s) 134, 258, 327
BstX2I RGATCY 1 cut(s) 327
BstYI RGATCY 1 cut(s) 327
BstZ17I GTATAC 1 cut(s) 93
Bsu15I ATCGAT 1 cut(s) 59
Bsu36I CCTNAGG 1 cut(s) 254
BsuRI GGCC 1 cut(s) 251
BsuTUI ATCGAT 1 cut(s) 59
Cfr13I GGNCC 1 cut(s) 250
ClaI ATCGAT 1 cut(s) 59
Csp6I GTAC 2 cut(s) 104, 202
CviAII CATG 1 cut(s) 199
CviJI RGCY 3 cut(s) 29, 41, 251
CviKI_1 RGCY 3 cut(s) 29, 41, 251
CviQI GTAC 2 cut(s) 104, 202
DdeI CTNAG 1 cut(s) 254
DpnI GATC 3 cut(s) 136, 260, 329
DpnII GATC 3 cut(s) 134, 258, 327
Eam1104I CTCTTC 2 cut(s) 125, 261
EarI CTCTTC 2 cut(s) 125, 261
Eco81I CCTNAGG 1 cut(s) 254
Eco88I CYCGRG 1 cut(s) 279
EcoO109I RGGNCCY 1 cut(s) 250
FaeI CATG 1 cut(s) 202
FaiI YATR 7 cut(s) 93, 97, 171, 176, 200, 307, 309
FatI CATG 1 cut(s) 198
FblI GTMKAC 1 cut(s) 92
HaeIII GGCC 1 cut(s) 251
Hin1II CATG 1 cut(s) 202
HinfI GANTC 2 cut(s) 184, 222
Hpy166II GTNNAC 1 cut(s) 93
Hpy188I TCNGA 1 cut(s) 139
Hpy188III TCNNGA 3 cut(s) 188, 226, 256
Hpy8I GTNNAC 1 cut(s) 93
HpyAV CCTTC 1 cut(s) 64
HpyCH4IV ACGT 1 cut(s) 240
HpyCH4V TGCA 3 cut(s) 123, 195, 323
HpyF3I CTNAG 1 cut(s) 254
HpySE526I ACGT 1 cut(s) 240
Hsp92II CATG 1 cut(s) 202
Kzo9I GATC 3 cut(s) 134, 258, 327
LpnPI CCDG 4 cut(s) 96, 201, 241, 309
MaeII ACGT 1 cut(s) 240
MaeIII GTNAC 1 cut(s) 301
MalI GATC 3 cut(s) 136, 260, 329
MboI GATC 3 cut(s) 134, 258, 327
MboII GAAGA 3 cut(s) 142, 152, 278
MflI RGATCY 1 cut(s) 327
MluCI AATT 2 cut(s) 108, 149
MnlI CCTC 2 cut(s) 263, 275
MseI TTAA 1 cut(s) 288
NdeII GATC 3 cut(s) 134, 258, 327
NlaIII CATG 1 cut(s) 202
NmuCI GTSAC 1 cut(s) 301
PaeR7I CTCGAG 1 cut(s) 279
PfeI GAWTC 2 cut(s) 184, 222
PspPI GGNCC 1 cut(s) 250
PspXI VCTCGAGB 1 cut(s) 279
PsuI RGATCY 1 cut(s) 327
RsaI GTAC 2 cut(s) 105, 203
RsaNI GTAC 2 cut(s) 104, 202
SaqAI TTAA 1 cut(s) 288
Sau3AI GATC 3 cut(s) 134, 258, 327
Sau96I GGNCC 1 cut(s) 250
ScaI AGTACT 1 cut(s) 105
SetI ASST 5 cut(s) 85, 92, 181, 243, 343
Sfr274I CTCGAG 1 cut(s) 279
SlaI CTCGAG 1 cut(s) 279
SmlI CTYRAG 1 cut(s) 279
SmoI CTYRAG 1 cut(s) 279
Sse9I AATT 2 cut(s) 108, 149
SsiI CCGC 1 cut(s) 297
TaiI ACGT 1 cut(s) 243
TaqI TCGA 2 cut(s) 59, 280
TasI AATT 2 cut(s) 108, 149
TatI WGTACW 2 cut(s) 103, 201
TfiI GAWTC 2 cut(s) 184, 222
Tru1I TTAA 1 cut(s) 288
Tru9I TTAA 1 cut(s) 288
TseFI GTSAC 1 cut(s) 301
Tsp45I GTSAC 1 cut(s) 301
TspDTI ATGAA 1 cut(s) 51
XhoI CTCGAG 1 cut(s) 279
XmiI GTMKAC 1 cut(s) 92
ZrmI AGTACT 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.