Rmu_sc0002329.1_g000024

DNA-directed RNA polymerases I, II, and III subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002329.1
Physical Location & Seq
Forward (+)
106502 .. 106864
363 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002329.1_g000024.1.cds

Sequence Viewer

Length: 363 bp
atggttttgacagaagaacgagttacgaggctctatagggttcgaaagacagtgatgcaaatgctgaaaggtcaggactatctaactgttgctcatgatctcaacatgacaatgttgcagtttaaaaacaaacatggagagaacatgaaaagggaggaccttactatcaatacaaggaagagaggtgacgagtctgatcaggtatttgatttggtatttagtgttcttgaagtagtattgtttggggtcctaactgatggttgttgtgtaccagatttatgtgtttttcccagacgaaccaaaagttggggtcaagacaatgaagagttacatcacacgcatgaatctggagaatgtgattag

Protein Analysis

120

Amino Acids

14.0

Weight (kDa)

5.71

Isoelectric Point (pI)

34.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000701)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G22320
fragaria_vesca FvH4_5g21560 FvH4_7g09301 FvH4_7g09301
malus_domestica MD02G1080800.v1.1 MD02G1093900.v1.1 MD15G1208600.v1.1
prunus_persica Prupe.2G121300_v2.0.a1 Prupe.2G121300_v2.0.a1 Prupe.2G121400_v2.0.a1 Prupe.2G121400_v2.0.a1
pyrus_communis pycom02g06410 pycom02g07430 pycom15g18470
rosa_chinensis RchiOBHm_Chr1g0332791 RchiOBHm_Chr1g0344101 RchiOBHm_Chr1g0344151 RchiOBHm_Chr1g0344171 RchiOBHm_Chr1g0345361 RchiOBHm_Chr1g0345421 RchiOBHm_Chr1g0345561 RchiOBHm_Chr1g0345591 RchiOBHm_Chr1g0345671 RchiOBHm_Chr1g0345701 RchiOBHm_Chr1g0345711 RchiOBHm_Chr1g0345721 RchiOBHm_Chr1g0345801 RchiOBHm_Chr1g0345851 RchiOBHm_Chr1g0345901 RchiOBHm_Chr1g0345921 RchiOBHm_Chr1g0345931 RchiOBHm_Chr1g0345951 RchiOBHm_Chr1g0345961 RchiOBHm_Chr7g0208981
rosa_laevigata RLG00000003175 RLG00000029644
rosa_multiflora Rmu_co8382943.1_g000001 Rmu_sc0000532.1_g000035 Rmu_sc0001292.1_g000003 Rmu_sc0001349.1_g000004 Rmu_sc0001692.1_g000006 Rmu_sc0001692.1_g000027 Rmu_sc0002329.1_g000024 Rmu_sc0002329.1_g000032 Rmu_sc0004239.1_g000023 Rmu_sc0008115.1_g000011
rosa_roxburghii Rroxscaffold_3G00238160 Rroxscaffold_3G00249920 Rroxscaffold_4G00310020 Rroxscaffold_4G00317980 Rroxscaffold_5G00344600
rosa_rugosa Rorug01G0103700 Rorug01G0103800 Rorug01G0103900 Rorug01G0171800 Rorug07G0107800
rosa_samantha Rh1BG097500 Rh1BG161500 Rh1CG122000 Rh1CG173900 Rh1CG180700 Rh1CG181100 Rh1DG133900 Rh1DG191900 Rh7AG242600 Rh7BG237400 Rh7DG249500
rosa_wichuraiana Rw1G010510 Rw1G016120 Rw1G016200 Rw1G016220 Rw1G016430 Rw1G016490 Rw7G020550

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 306
AfaI GTAC 1 cut(s) 270
AfiI CCNNNNNNNGG 1 cut(s) 306
AgsI TTSAA 1 cut(s) 230
AjuI GAANNNNNNNTTGG 2 cut(s) 289, 321
AspS9I GGNCC 2 cut(s) 157, 247
AsuHPI GGTGA 1 cut(s) 197
AsuII TTCGAA 1 cut(s) 43
AvaII GGWCC 2 cut(s) 157, 247
BccI CCATC 1 cut(s) 251
BclI TGATCA 1 cut(s) 196
BfmI CTRYAG 1 cut(s) 34
Bme18I GGWCC 2 cut(s) 157, 247
BmgT120I GGNCC 2 cut(s) 157, 247
BmiI GGNNCC 1 cut(s) 248
BmsI GCATC 1 cut(s) 45
Bpu14I TTCGAA 1 cut(s) 43
Bsc4I CCNNNNNNNGG 1 cut(s) 306
BseLI CCNNNNNNNGG 1 cut(s) 306
BslI CCNNNNNNNGG 1 cut(s) 306
Bsp119I TTCGAA 1 cut(s) 43
Bsp143I GATC 2 cut(s) 97, 196
BspHI TCATGA 1 cut(s) 94
BspLI GGNNCC 1 cut(s) 248
BspT104I TTCGAA 1 cut(s) 43
BssMI GATC 2 cut(s) 97, 196
Bst4CI ACNGT 2 cut(s) 52, 88
Bst6I CTCTTC 2 cut(s) 173, 318
BstBI TTCGAA 1 cut(s) 43
BstKTI GATC 2 cut(s) 100, 199
BstMBI GATC 2 cut(s) 97, 196
BstSFI CTRYAG 1 cut(s) 34
BtsIMutI CAGTG 1 cut(s) 57
CciI TCATGA 1 cut(s) 94
Cfr13I GGNCC 2 cut(s) 157, 247
Csp6I GTAC 1 cut(s) 269
CviAII CATG 5 cut(s) 95, 106, 134, 145, 341
CviJI RGCY 1 cut(s) 31
CviKI_1 RGCY 1 cut(s) 31
CviQI GTAC 1 cut(s) 269
DpnI GATC 2 cut(s) 99, 198
DpnII GATC 2 cut(s) 97, 196
DraI TTTAAA 1 cut(s) 124
Eam1104I CTCTTC 2 cut(s) 173, 318
EarI CTCTTC 2 cut(s) 173, 318
Eco47I GGWCC 2 cut(s) 157, 247
EcoO109I RGGNCCY 2 cut(s) 157, 247
FaeI CATG 5 cut(s) 98, 109, 137, 148, 344
FaiI YATR 7 cut(s) 36, 96, 107, 135, 146, 280, 342
FatI CATG 5 cut(s) 94, 105, 133, 144, 340
FbaI TGATCA 1 cut(s) 196
Hin1II CATG 5 cut(s) 98, 109, 137, 148, 344
HinfI GANTC 2 cut(s) 191, 344
HphI GGTGA 1 cut(s) 197
Hpy166II GTNNAC 1 cut(s) 269
Hpy188I TCNGA 1 cut(s) 196
Hpy188III TCNNGA 5 cut(s) 74, 95, 227, 314, 348
Hpy8I GTNNAC 1 cut(s) 269
HpyCH4III ACNGT 2 cut(s) 52, 88
HpyCH4V TGCA 2 cut(s) 58, 118
Hsp92II CATG 5 cut(s) 98, 109, 137, 148, 344
Ksp22I TGATCA 1 cut(s) 196
Kzo9I GATC 2 cut(s) 97, 196
LpnPI CCDG 5 cut(s) 59, 185, 285, 304, 333
LweI GCATC 1 cut(s) 45
MaeIII GTNAC 3 cut(s) 22, 185, 327
MalI GATC 2 cut(s) 99, 198
MboI GATC 2 cut(s) 97, 196
MboII GAAGA 3 cut(s) 26, 190, 335
MlyI GAGTC 1 cut(s) 200
MnlI CCTC 3 cut(s) 21, 148, 176
MseI TTAA 1 cut(s) 123
MslI CAYNNNNRTG 2 cut(s) 110, 339
NdeII GATC 2 cut(s) 97, 196
NlaIII CATG 5 cut(s) 98, 109, 137, 148, 344
NlaIV GGNNCC 1 cut(s) 248
NmuCI GTSAC 1 cut(s) 185
NspV TTCGAA 1 cut(s) 43
PagI TCATGA 1 cut(s) 94
PfeI GAWTC 1 cut(s) 344
PflMI CCANNNNNTGG 1 cut(s) 306
PleI GAGTC 1 cut(s) 199
PpsI GAGTC 1 cut(s) 199
PpuMI RGGWCCY 2 cut(s) 157, 247
Psp5II RGGWCCY 2 cut(s) 157, 247
PspN4I GGNNCC 1 cut(s) 248
PspPI GGNCC 2 cut(s) 157, 247
PspPPI RGGWCCY 2 cut(s) 157, 247
PsrI GAACNNNNNNTAC 2 cut(s) 207, 239
RsaI GTAC 1 cut(s) 270
RsaNI GTAC 1 cut(s) 269
RseI CAYNNNNRTG 2 cut(s) 110, 339
SaqAI TTAA 1 cut(s) 123
Sau3AI GATC 2 cut(s) 97, 196
Sau96I GGNCC 2 cut(s) 157, 247
SchI GAGTC 1 cut(s) 200
SetI ASST 4 cut(s) 73, 162, 187, 204
SfaNI GCATC 1 cut(s) 45
SfcI CTRYAG 1 cut(s) 34
SfuI TTCGAA 1 cut(s) 43
SinI GGWCC 2 cut(s) 157, 247
SmiMI CAYNNNNRTG 2 cut(s) 110, 339
TaaI ACNGT 2 cut(s) 52, 88
TaqI TCGA 1 cut(s) 43
TfiI GAWTC 1 cut(s) 344
Tru1I TTAA 1 cut(s) 123
Tru9I TTAA 1 cut(s) 123
TscAI CASTG 1 cut(s) 57
TseFI GTSAC 1 cut(s) 185
Tsp45I GTSAC 1 cut(s) 185
TspDTI ATGAA 3 cut(s) 161, 336, 357
TspRI CASTG 1 cut(s) 57
Van91I CCANNNNNTGG 1 cut(s) 306
VpaK11BI GGWCC 2 cut(s) 157, 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.