Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003315.1

Orthogroup ID

OG0003270

Physical Location & Seq

Genomic Coordinates Forward (+)

75260 .. 76907

Gene Structure 1648 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003315.1_g000020.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1362 bp

atgagctcccaatttgaccccactgtcgacagtgaccagaaatctttcaattccgcaatcaacggggctgttgctgcttctgttatttctactgtggtactgatcattgctgttacagccattatatgtgccattattaactgcgtgaaaaagtctggaaattctattccaatttctgccaagataagtagtagcaataccgacaacgattccaacaacaaagtagcagtggacttgagacgtgatcaatttccagtagcttttgattcccaggctgagtttccgacaatcaaagggtttctaagcaacatggcgagagagaagcctataacttactcagcaaagcaaattgcagaattcacacataactatagctactctaacatattaggttcaggtggttttggagtagtatataaagggcttctcgaaaatggagtgcaagtggctgtcaaggtccttacgaacaacaatagggctaagatagtagaagagcagtttatggcagaagttggagccttgggaagaacttaccatgtcaatttggttagactctatggcttctgcttcgcccccgaaatgaaagcccttgtctatgagtacatggagaaaggttctcttgacaagttattgttcagtgacaatggagaactagatttagagaagcttcatgttattgcagtccaaactgcaaaagggttggcttatttgcatgaggagtgtgaacaaaagatcattcactatgatattaagcccgaaaatgtgcttctggatgagaacttgaatcccaaggttgcggattttggactcgccaggctttgcaatagagggagtagtcgaatgctcctaactaacttcagagggacagccggatatgcagccccagagatgtggaagccttatcctgtgactcacaaatgtgatgtttacagttttggtattcttctctttgagattgttggaagaagaagacactgcgacgataatgtgagcgagtctcgagactggctacctaagtggacatggaacatgtttgagaaaaatgacttagcagcactattattgcgctgtgggatcgaagagagagacaggggacaagcagagaggatgttaatgatagctctgtggtgcattcagcattcaccagaagcaagacctctcatgagcaatgtagtgcaaatgttggaggggcataaagaaattactccacctccttgcccctttgaacatttgcaatctccacaactgaatttcagtcaaaatagtggaacagatgacagcactagtacttcagcatcagccacaatgattgatccccaccccaatgttgcacatgaaattgagcttgttgttgtcctatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pkinase Pkinase_Tyr

Protein Analysis

453

Amino Acids

50.4

Weight (kDa)

5.69

Isoelectric Point (pI)

39.16

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003270)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g22030 FvH4_4g22030
malus_domestica	MD02G1307500.v1.1 MD07G1018100.v1.1
prunus_persica	Prupe.3G089700_v2.0.a1 Prupe.3G089700_v2.0.a1
pyrus_communis	pycom07g01390
rosa_chinensis	RchiOBHm_Chr1g0326751 RchiOBHm_Chr1g0326841 RchiOBHm_Chr1g0326851 RchiOBHm_Chr1g0326921
rosa_laevigata	RLG00000030051 RLG00000030053 RLG00000030059
rosa_multiflora	Rmu_sc0000842.1_g000010 Rmu_sc0000842.1_g000033 Rmu_sc0000842.1_g000035 Rmu_sc0003315.1_g000010 Rmu_sc0003315.1_g000016 Rmu_sc0003315.1_g000020 Rmu_sc0005098.1_g000011 Rmu_sc0017564.1_g000001 Rmu_sc0017869.1_g000003
rosa_roxburghii	Rroxscaffold_4G00323520 Rroxscaffold_4G00323540 Rroxscaffold_4G00323560
rosa_rugosa	Rorug01G0061700 Rorug01G0062000
rosa_samantha	Rh1AG078300 Rh1AG079000 Rh1AG079200 Rh1AG079300 Rh1CG076900 Rh1DG083300
rosa_wichuraiana	Rw1G006260 Rw1G006270 Rw1G006290

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	23
AccI	GTMKAC	1 cut(s)	27
AciI	CCGC	2 cut(s)	54, 797
AclWI	GGATC	2 cut(s)	1082, 1307
AcsI	RAATTY	3 cut(s)	160, 356, 1249
AcuI	CTGAAG	2 cut(s)	841, 1275
AfaI	GTAC	3 cut(s)	99, 602, 1288
AflIII	ACRYGT	1 cut(s)	1029
AgsI	TTSAA	3 cut(s)	49, 784, 1226
AhlI	ACTAGT	1 cut(s)	1283
AjiI	CACGTC	1 cut(s)	242
AjnI	CCWGG	2 cut(s)	270, 812
AleI	CACNNNNGTG	1 cut(s)	918
AluBI	AGCT	6 cut(s)	6, 260, 375, 667, 1121, 1345
AluI	AGCT	6 cut(s)	6, 260, 375, 667, 1121, 1345
Alw21I	GWGCWC	1 cut(s)	8
Alw26I	GTCTC	4 cut(s)	232, 996, 1002, 1080
AlwI	GGATC	2 cut(s)	1082, 1307
Ama87I	CYCGRG	1 cut(s)	999
ApeKI	GCWGC	3 cut(s)	74, 878, 1052
ApoI	RAATTY	3 cut(s)	160, 356, 1249
Asp700I	GAANNNNTTC	1 cut(s)	44
AspLEI	GCGC	1 cut(s)	1068
AspS9I	GGNCC	1 cut(s)	457
AsuHPI	GGTGA	1 cut(s)	1134
AvaI	CYCGRG	1 cut(s)	999
AvaII	GGWCC	1 cut(s)	457
BanII	GRGCYC	1 cut(s)	8
BbsI	GAAGAC	1 cut(s)	976
Bbv12I	GWGCWC	1 cut(s)	8
BbvI	GCAGC	3 cut(s)	61, 890, 1064
BciT130I	CCWGG	2 cut(s)	272, 814
BclI	TGATCA	2 cut(s)	102, 244
BcoDI	GTCTC	4 cut(s)	232, 996, 1002, 1080
BcuI	ACTAGT	1 cut(s)	1283
BfaI	CTAG	2 cut(s)	653, 1284
BfmI	CTRYAG	2 cut(s)	370, 1358
BisI	GCNGC	3 cut(s)	75, 879, 1053
BlsI	GCNGC	3 cut(s)	76, 880, 1054
BmcAI	AGTACT	1 cut(s)	1288
Bme1390I	CCNGG	2 cut(s)	272, 814
Bme18I	GGWCC	1 cut(s)	457
BmeT110I	CYCGRG	1 cut(s)	999
BmgBI	CACGTC	1 cut(s)	242
BmgT120I	GGNCC	1 cut(s)	457
BmiI	GGNNCC	1 cut(s)	517
BmrFI	CCNGG	2 cut(s)	272, 814
BmsI	GCATC	1 cut(s)	1304
BpiI	GAAGAC	1 cut(s)	976
BplI	GAGNNNNNCTC	2 cut(s)	982, 1014
BpuEI	CTTGAG	1 cut(s)	256
BsaJI	CCNNGG	3 cut(s)	270, 519, 789
BsaXI	ACNNNNNCTCC	4 cut(s)	429, 459, 1195, 1225
Bse1I	ACTGG	2 cut(s)	254, 1010
Bse3DI	GCAATG	2 cut(s)	105, 1174
BseBI	CCWGG	2 cut(s)	272, 814
BseDI	CCNNGG	3 cut(s)	270, 519, 789
BseGI	GGATG	2 cut(s)	778, 1113
BseMI	GCAATG	2 cut(s)	105, 1174
BseMII	CTCAG	2 cut(s)	267, 351
BseNI	ACTGG	2 cut(s)	254, 1010
BseRI	GAGGAG	1 cut(s)	731
BseXI	GCAGC	3 cut(s)	61, 890, 1064
BsiHKAI	GWGCWC	1 cut(s)	8
BsiHKCI	CYCGRG	1 cut(s)	999
BsiSI	CCGG	1 cut(s)	870
BslFI	GGGAC	2 cut(s)	877, 1107
BsmAI	GTCTC	4 cut(s)	232, 996, 1002, 1080
BsmBI	CGTCTC	1 cut(s)	232
BsmFI	GGGAC	2 cut(s)	877, 1107
BsmI	GAATGC	3 cut(s)	846, 1131, 1138
BsoBI	CYCGRG	1 cut(s)	999
Bsp1286I	GDGCHC	1 cut(s)	8
Bsp143I	GATC	5 cut(s)	102, 244, 732, 1074, 1312
BspACI	CCGC	2 cut(s)	54, 797
BspCNI	CTCAG	2 cut(s)	268, 350
BspHI	TCATGA	1 cut(s)	1161
BspLI	GGNNCC	1 cut(s)	517
BspPI	GGATC	2 cut(s)	1082, 1307
BspQI	GCTCTTC	1 cut(s)	486
BsrDI	GCAATG	2 cut(s)	105, 1174
BsrI	ACTGG	2 cut(s)	254, 1010
BssECI	CCNNGG	3 cut(s)	270, 519, 789
BssMI	GATC	5 cut(s)	102, 244, 732, 1074, 1312
BssT1I	CCWWGG	2 cut(s)	519, 789
Bst2UI	CCWGG	2 cut(s)	272, 814
Bst4CI	ACNGT	4 cut(s)	25, 32, 94, 932
Bst6I	CTCTTC	2 cut(s)	486, 1074
BstDEI	CTNAG	6 cut(s)	276, 302, 337, 480, 1014, 1048
BstF5I	GGATG	2 cut(s)	778, 1113
BstHHI	GCGC	1 cut(s)	1068
BstKTI	GATC	5 cut(s)	105, 247, 735, 1077, 1315
BstMAI	GTCTC	4 cut(s)	232, 996, 1002, 1080
BstMBI	GATC	5 cut(s)	102, 244, 732, 1074, 1312
BstMWI	GCNNNNNNNGC	3 cut(s)	74, 116, 875
BstNI	CCWGG	2 cut(s)	272, 814
BstNSI	RCATGY	1 cut(s)	1033
BstSCI	CCNGG	2 cut(s)	270, 812
BstSFI	CTRYAG	2 cut(s)	370, 1358
BstV1I	GCAGC	3 cut(s)	61, 890, 1064
BstV2I	GAAGAC	1 cut(s)	976
BstXI	CCANNNNNNTGG	1 cut(s)	891
BtrI	CACGTC	1 cut(s)	242
BtsCI	GGATG	2 cut(s)	778, 1113
BtsI	GCAGTG	2 cut(s)	234, 973
BtsIMutI	CAGTG	5 cut(s)	21, 37, 234, 643, 973
CciI	TCATGA	1 cut(s)	1161
CfoI	GCGC	1 cut(s)	1068
Cfr13I	GGNCC	1 cut(s)	457
Csp6I	GTAC	3 cut(s)	98, 601, 1287
CspCI	CAANNNNNGTGG	2 cut(s)	1291, 1326
CviAII	CATG	9 cut(s)	310, 536, 604, 671, 713, 1023, 1030, 1162, 1334
CviQI	GTAC	3 cut(s)	98, 601, 1287
DdeI	CTNAG	6 cut(s)	276, 302, 337, 480, 1014, 1048
DpnI	GATC	5 cut(s)	104, 246, 734, 1076, 1314
DpnII	GATC	5 cut(s)	102, 244, 732, 1074, 1312
DrdI	GACNNNNNNGTC	1 cut(s)	23
DseDI	GACNNNNNNGTC	1 cut(s)	23
Eam1104I	CTCTTC	2 cut(s)	486, 1074
EarI	CTCTTC	2 cut(s)	486, 1074
Ecl136II	GAGCTC	1 cut(s)	6
Eco130I	CCWWGG	2 cut(s)	519, 789
Eco24I	GRGCYC	1 cut(s)	8
Eco47I	GGWCC	1 cut(s)	457
Eco53kI	GAGCTC	1 cut(s)	6
Eco57I	CTGAAG	2 cut(s)	841, 1275
Eco88I	CYCGRG	1 cut(s)	999
EcoICRI	GAGCTC	1 cut(s)	6
EcoO109I	RGGNCCY	1 cut(s)	457
EcoRI	GAATTC	1 cut(s)	356
EcoRII	CCWGG	2 cut(s)	270, 812
EcoT14I	CCWWGG	2 cut(s)	519, 789
EcoT38I	GRGCYC	1 cut(s)	8
ErhI	CCWWGG	2 cut(s)	519, 789
Esp3I	CGTCTC	1 cut(s)	232
FaeI	CATG	9 cut(s)	313, 539, 607, 674, 716, 1026, 1033, 1165, 1337
FalI	AAGNNNNNCTT	2 cut(s)	603, 635
FaqI	GGGAC	2 cut(s)	877, 1107
FatI	CATG	9 cut(s)	309, 535, 603, 670, 712, 1022, 1029, 1161, 1333
FbaI	TGATCA	2 cut(s)	102, 244
FblI	GTMKAC	1 cut(s)	27
Fnu4HI	GCNGC	3 cut(s)	75, 879, 1053
FokI	GGATG	2 cut(s)	785, 1120
FriOI	GRGCYC	1 cut(s)	8
Fsp4HI	GCNGC	3 cut(s)	75, 879, 1053
FspBI	CTAG	2 cut(s)	653, 1284
GlaI	GCGC	1 cut(s)	1067
GluI	GCNGC	3 cut(s)	75, 879, 1053
HapII	CCGG	1 cut(s)	870
HhaI	GCGC	1 cut(s)	1068
Hin1II	CATG	9 cut(s)	313, 539, 607, 674, 716, 1026, 1033, 1165, 1337
Hin6I	GCGC	1 cut(s)	1066
HinP1I	GCGC	1 cut(s)	1066
HincII	GTYRAC	1 cut(s)	28
HindII	GTYRAC	1 cut(s)	28
HindIII	AAGCTT	1 cut(s)	665
HinfI	GANTC	7 cut(s)	209, 266, 552, 784, 807, 910, 995
HpaII	CCGG	1 cut(s)	870
HphI	GGTGA	1 cut(s)	1134
Hpy166II	GTNNAC	5 cut(s)	28, 232, 725, 928, 1020
Hpy188I	TCNGA	2 cut(s)	285, 860
Hpy188III	TCNNGA	7 cut(s)	156, 428, 620, 770, 999, 1001, 1162
Hpy8I	GTNNAC	5 cut(s)	28, 232, 725, 928, 1020
Hpy99I	CGWCG	1 cut(s)	983
HpyCH4III	ACNGT	4 cut(s)	25, 32, 94, 932
HpyCH4IV	ACGT	1 cut(s)	241
HpyF10VI	GCNNNNNNNGC	3 cut(s)	74, 116, 875
HpyF3I	CTNAG	6 cut(s)	276, 302, 337, 480, 1014, 1048
HpySE526I	ACGT	1 cut(s)	241
Hsp92II	CATG	9 cut(s)	313, 539, 607, 674, 716, 1026, 1033, 1165, 1337
HspAI	GCGC	1 cut(s)	1066
Ksp22I	TGATCA	2 cut(s)	102, 244
Kzo9I	GATC	5 cut(s)	102, 244, 732, 1074, 1312
LguI	GCTCTTC	1 cut(s)	486
LmnI	GCTCC	3 cut(s)	11, 515, 849
Lsp1109I	GCAGC	3 cut(s)	61, 890, 1064
LweI	GCATC	1 cut(s)	1304
MaeI	CTAG	2 cut(s)	653, 1284
MaeII	ACGT	1 cut(s)	241
MaeIII	GTNAC	4 cut(s)	32, 112, 638, 907
MalI	GATC	5 cut(s)	104, 246, 734, 1076, 1314
MboI	GATC	5 cut(s)	102, 244, 732, 1074, 1312
MboII	GAAGA	7 cut(s)	503, 537, 935, 975, 978, 981, 1091
MhlI	GDGCHC	1 cut(s)	8
MlyI	GAGTC	4 cut(s)	546, 801, 904, 1004
MmeI	TCCRAC	5 cut(s)	237, 308, 493, 940, 1164
MnlI	CCTC	7 cut(s)	709, 821, 854, 1098, 1167, 1180, 1221
MroXI	GAANNNNTTC	1 cut(s)	44
MseI	TTAA	3 cut(s)	138, 750, 1112
MslI	CAYNNNNRTG	2 cut(s)	918, 1323
MspI	CCGG	1 cut(s)	870
MspR9I	CCNGG	2 cut(s)	272, 814
Mva1269I	GAATGC	3 cut(s)	846, 1131, 1138
MvaI	CCWGG	2 cut(s)	272, 814
MwoI	GCNNNNNNNGC	3 cut(s)	74, 116, 875
NdeII	GATC	5 cut(s)	102, 244, 732, 1074, 1312
NlaIII	CATG	9 cut(s)	313, 539, 607, 674, 716, 1026, 1033, 1165, 1337
NlaIV	GGNNCC	1 cut(s)	517
NmuCI	GTSAC	3 cut(s)	32, 638, 907
NspI	RCATGY	1 cut(s)	1033
OliI	CACNNNNGTG	1 cut(s)	918
PaeR7I	CTCGAG	1 cut(s)	999
PagI	TCATGA	1 cut(s)	1161
PciI	ACATGT	1 cut(s)	1029
PciSI	GCTCTTC	1 cut(s)	486
PctI	GAATGC	3 cut(s)	846, 1131, 1138
PdmI	GAANNNNTTC	1 cut(s)	44
PfeI	GAWTC	3 cut(s)	209, 266, 784
PkrI	GCNGC	3 cut(s)	76, 880, 1054
PleI	GAGTC	4 cut(s)	546, 801, 904, 1003
PpsI	GAGTC	4 cut(s)	546, 801, 904, 1003
PpuMI	RGGWCCY	1 cut(s)	457
PscI	ACATGT	1 cut(s)	1029
Psp124BI	GAGCTC	1 cut(s)	8
Psp5II	RGGWCCY	1 cut(s)	457
Psp6I	CCWGG	2 cut(s)	270, 812
PspGI	CCWGG	2 cut(s)	270, 812
PspN4I	GGNNCC	1 cut(s)	517
PspPI	GGNCC	1 cut(s)	457
PspPPI	RGGWCCY	1 cut(s)	457
RsaI	GTAC	3 cut(s)	99, 602, 1288
RsaNI	GTAC	3 cut(s)	98, 601, 1287
RseI	CAYNNNNRTG	2 cut(s)	918, 1323
SacI	GAGCTC	1 cut(s)	8
SalI	GTCGAC	1 cut(s)	26
SapI	GCTCTTC	1 cut(s)	486
SaqAI	TTAA	3 cut(s)	138, 750, 1112
SatI	GCNGC	3 cut(s)	75, 879, 1053
Sau3AI	GATC	5 cut(s)	102, 244, 732, 1074, 1312
Sau96I	GGNCC	1 cut(s)	457
ScaI	AGTACT	1 cut(s)	1288
SchI	GAGTC	4 cut(s)	546, 801, 904, 1004
ScrFI	CCNGG	2 cut(s)	272, 814
SduI	GDGCHC	1 cut(s)	8
SfaNI	GCATC	1 cut(s)	1304
SfcI	CTRYAG	2 cut(s)	370, 1358
Sfr274I	CTCGAG	1 cut(s)	999
SinI	GGWCC	1 cut(s)	457
SlaI	CTCGAG	1 cut(s)	999
SmiMI	CAYNNNNRTG	2 cut(s)	918, 1323
SmlI	CTYRAG	2 cut(s)	235, 999
SmoI	CTYRAG	2 cut(s)	235, 999
SpeI	ACTAGT	1 cut(s)	1283
SsiI	CCGC	2 cut(s)	54, 797
SspMI	CTAG	2 cut(s)	653, 1284
SstI	GAGCTC	1 cut(s)	8
StyD4I	CCNGG	2 cut(s)	270, 812
StyI	CCWWGG	2 cut(s)	519, 789
TaaI	ACNGT	4 cut(s)	25, 32, 94, 932
TaiI	ACGT	1 cut(s)	244
TaqI	TCGA	5 cut(s)	27, 429, 838, 1000, 1077
TatI	WGTACW	2 cut(s)	600, 1286
TfiI	GAWTC	3 cut(s)	209, 266, 784
Tru1I	TTAA	3 cut(s)	138, 750, 1112
Tru9I	TTAA	3 cut(s)	138, 750, 1112
TscAI	CASTG	5 cut(s)	28, 37, 234, 643, 980
TseFI	GTSAC	3 cut(s)	32, 638, 907
TseI	GCWGC	3 cut(s)	74, 878, 1052
Tsp45I	GTSAC	3 cut(s)	32, 638, 907
TspDTI	ATGAA	3 cut(s)	596, 659, 1350
TspRI	CASTG	5 cut(s)	28, 37, 234, 643, 980
VpaK11BI	GGWCC	1 cut(s)	457
XapI	RAATTY	3 cut(s)	160, 356, 1249
XceI	RCATGY	1 cut(s)	1033
XhoI	CTCGAG	1 cut(s)	999
XmiI	GTMKAC	1 cut(s)	27
XmnI	GAANNNNTTC	1 cut(s)	44
XspI	CTAG	2 cut(s)	653, 1284
ZrmI	AGTACT	1 cut(s)	1288

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.