Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0017869.1

Orthogroup ID

OG0003270

Physical Location & Seq

Genomic Coordinates Reverse (-)

9828 .. 11003

Gene Structure 1176 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0017869.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1176 bp

atgagtagtaacagtaccgacaacgattccaacaacaaagtagcagtggacttgagacatgatcaatttccagtagcttttgattcccaggctgagtttccaacaatcaaagggtttctaagaaacatggcaagggagaagcctataacttactcagcaaagcaaattgcagaattcacacataactatagctactctaatatattaggttcaggtggttttggagtagtatataaagggcttctcgaaaatggagtacaagtggctgtcaaggtccttaccaaccacaatagggctaagatagttgaagagcagtttatggcagaagttggaaccttgggaagaacttaccacgtcaatctggttagactctatggcttctgcttcgaccccgaaatgaaagccctcgtctacgagtacatggagaatggttctcttgacaagttattgttcagtgacaatggagaagtagatttagagaagctgcatgttattgcagtccaaactgcaaaagggttggcttatttgcatgaggagtgtgaacaaaaaatcattcactatgatattaagcctgaaaatgtacttctagatgagaacttgaatcctaaggttgcggattttggactcgccaagctttgcaatagagggagtagtcgaatgcttctaaccaatttcagagggacagctggatatgcagccccagagatgtggatgccttatcccgtgactcacaaatgtgatgtttacagttttggtattcttctctttgagattgttggaaaaagaagacactgcgacgataatttgagccagtcccgagactggctacctaagtggacatggaacatgtttgagaaaaatgacttagcagcactattattgcgctgtgggatcgaagagagagacaggggacaagcagagaggatgttaatgatagctctgtggtgcattcagcattcaccagaagcaagacctctcatgagcaatgtagtgcaaatgttggaggggcataaagaaattactccacctccttgcccctttgaacatttgcaatctgcacaactgaatttcagtcaaaatagtggaacagatgacgacactagtactttggcatcagccacaatgattgatccacaccctagtgtggcacatgaaattgagctagttgtcgaatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Pkinase Pkinase_Tyr

Protein Analysis

391

Amino Acids

44.22

Weight (kDa)

5.41

Isoelectric Point (pI)

43.16

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003270)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g22030 FvH4_4g22030
malus_domestica	MD02G1307500.v1.1 MD07G1018100.v1.1
prunus_persica	Prupe.3G089700_v2.0.a1 Prupe.3G089700_v2.0.a1
pyrus_communis	pycom07g01390
rosa_chinensis	RchiOBHm_Chr1g0326751 RchiOBHm_Chr1g0326841 RchiOBHm_Chr1g0326851 RchiOBHm_Chr1g0326921
rosa_laevigata	RLG00000030051 RLG00000030053 RLG00000030059
rosa_multiflora	Rmu_sc0000842.1_g000010 Rmu_sc0000842.1_g000033 Rmu_sc0000842.1_g000035 Rmu_sc0003315.1_g000010 Rmu_sc0003315.1_g000016 Rmu_sc0003315.1_g000020 Rmu_sc0005098.1_g000011 Rmu_sc0017564.1_g000001 Rmu_sc0017869.1_g000003
rosa_roxburghii	Rroxscaffold_4G00323520 Rroxscaffold_4G00323540 Rroxscaffold_4G00323560
rosa_rugosa	Rorug01G0061700 Rorug01G0062000
rosa_samantha	Rh1AG078300 Rh1AG079000 Rh1AG079200 Rh1AG079300 Rh1CG076900 Rh1DG083300
rosa_wichuraiana	Rw1G006260 Rw1G006270 Rw1G006290

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	411
AciI	CCGC	1 cut(s)	614
AclWI	GGATC	2 cut(s)	899, 1124
AcsI	RAATTY	2 cut(s)	173, 1066
AfaI	GTAC	5 cut(s)	16, 258, 419, 582, 1105
AfiI	CCNNNNNNNGG	3 cut(s)	292, 822, 1144
AflIII	ACRYGT	1 cut(s)	846
AgsI	TTSAA	3 cut(s)	308, 601, 1043
AhlI	ACTAGT	1 cut(s)	1100
AjiI	CACGTC	1 cut(s)	355
AjnI	CCWGG	1 cut(s)	87
AleI	CACNNNNGTG	2 cut(s)	735, 1140
AluBI	AGCT	7 cut(s)	77, 192, 484, 634, 686, 938, 1162
AluI	AGCT	7 cut(s)	77, 192, 484, 634, 686, 938, 1162
Alw26I	GTCTC	3 cut(s)	49, 813, 897
AlwI	GGATC	2 cut(s)	899, 1124
Ama87I	CYCGRG	1 cut(s)	816
ApeKI	GCWGC	3 cut(s)	484, 695, 869
ApoI	RAATTY	2 cut(s)	173, 1066
AspLEI	GCGC	1 cut(s)	885
AspS9I	GGNCC	1 cut(s)	274
AsuHPI	GGTGA	1 cut(s)	951
AvaI	CYCGRG	1 cut(s)	816
AvaII	GGWCC	1 cut(s)	274
AxyI	CCTNAGG	1 cut(s)	606
BbsI	GAAGAC	1 cut(s)	793
BbvI	GCAGC	3 cut(s)	471, 707, 881
BciT130I	CCWGG	1 cut(s)	89
BclI	TGATCA	1 cut(s)	61
BcoDI	GTCTC	3 cut(s)	49, 813, 897
BcuI	ACTAGT	1 cut(s)	1100
BfaI	CTAG	4 cut(s)	587, 1101, 1140, 1163
BfmI	CTRYAG	1 cut(s)	187
BisI	GCNGC	3 cut(s)	485, 696, 870
BlsI	GCNGC	3 cut(s)	486, 697, 871
BmcAI	AGTACT	1 cut(s)	1105
Bme1390I	CCNGG	1 cut(s)	89
Bme18I	GGWCC	1 cut(s)	274
BmeT110I	CYCGRG	1 cut(s)	816
BmgBI	CACGTC	1 cut(s)	355
BmgT120I	GGNCC	1 cut(s)	274
BmiI	GGNNCC	1 cut(s)	334
BmrFI	CCNGG	1 cut(s)	89
BmsI	GCATC	2 cut(s)	702, 1121
BpiI	GAAGAC	1 cut(s)	793
BpuEI	CTTGAG	1 cut(s)	73
BsaJI	CCNNGG	2 cut(s)	87, 336
BsaXI	ACNNNNNCTCC	4 cut(s)	246, 276, 1012, 1042
Bsc4I	CCNNNNNNNGG	3 cut(s)	292, 822, 1144
Bse1I	ACTGG	3 cut(s)	71, 811, 827
Bse21I	CCTNAGG	1 cut(s)	606
Bse3DI	GCAATG	1 cut(s)	991
BseBI	CCWGG	1 cut(s)	89
BseDI	CCNNGG	2 cut(s)	87, 336
BseGI	GGATG	2 cut(s)	717, 930
BseLI	CCNNNNNNNGG	3 cut(s)	292, 822, 1144
BseMI	GCAATG	1 cut(s)	991
BseMII	CTCAG	2 cut(s)	84, 168
BseNI	ACTGG	3 cut(s)	71, 811, 827
BseRI	GAGGAG	1 cut(s)	548
BseXI	GCAGC	3 cut(s)	471, 707, 881
BsgI	GTGCAG	1 cut(s)	1041
BsiHKCI	CYCGRG	1 cut(s)	816
BslFI	GGGAC	3 cut(s)	694, 799, 924
BslI	CCNNNNNNNGG	3 cut(s)	292, 822, 1144
BsmAI	GTCTC	3 cut(s)	49, 813, 897
BsmFI	GGGAC	3 cut(s)	694, 799, 924
BsmI	GAATGC	3 cut(s)	663, 948, 955
BsoBI	CYCGRG	1 cut(s)	816
Bsp143I	GATC	3 cut(s)	61, 891, 1129
BspACI	CCGC	1 cut(s)	614
BspCNI	CTCAG	2 cut(s)	85, 167
BspHI	TCATGA	1 cut(s)	978
BspLI	GGNNCC	1 cut(s)	334
BspPI	GGATC	2 cut(s)	899, 1124
BspQI	GCTCTTC	1 cut(s)	303
BsrDI	GCAATG	1 cut(s)	991
BsrI	ACTGG	3 cut(s)	71, 811, 827
BssECI	CCNNGG	2 cut(s)	87, 336
BssMI	GATC	3 cut(s)	61, 891, 1129
BssT1I	CCWWGG	1 cut(s)	336
Bst2UI	CCWGG	1 cut(s)	89
Bst4CI	ACNGT	2 cut(s)	14, 749
Bst6I	CTCTTC	2 cut(s)	303, 891
BstDEI	CTNAG	7 cut(s)	93, 119, 154, 297, 606, 831, 865
BstF5I	GGATG	2 cut(s)	717, 930
BstHHI	GCGC	1 cut(s)	885
BstKTI	GATC	3 cut(s)	64, 894, 1132
BstMAI	GTCTC	3 cut(s)	49, 813, 897
BstMBI	GATC	3 cut(s)	61, 891, 1129
BstMWI	GCNNNNNNNGC	1 cut(s)	692
BstNI	CCWGG	1 cut(s)	89
BstNSI	RCATGY	2 cut(s)	491, 850
BstSCI	CCNGG	1 cut(s)	87
BstSFI	CTRYAG	1 cut(s)	187
BstV1I	GCAGC	3 cut(s)	471, 707, 881
BstV2I	GAAGAC	1 cut(s)	793
BstXI	CCANNNNNNTGG	1 cut(s)	708
Bsu36I	CCTNAGG	1 cut(s)	606
BtrI	CACGTC	1 cut(s)	355
BtsCI	GGATG	2 cut(s)	717, 930
BtsI	GCAGTG	2 cut(s)	51, 790
BtsIMutI	CAGTG	3 cut(s)	51, 460, 790
CciI	TCATGA	1 cut(s)	978
CfoI	GCGC	1 cut(s)	885
Cfr13I	GGNCC	1 cut(s)	274
Csp6I	GTAC	5 cut(s)	15, 257, 418, 581, 1104
CspCI	CAANNNNNGTGG	2 cut(s)	1108, 1143
CviAII	CATG	9 cut(s)	59, 127, 421, 488, 530, 840, 847, 979, 1151
CviQI	GTAC	5 cut(s)	15, 257, 418, 581, 1104
DdeI	CTNAG	7 cut(s)	93, 119, 154, 297, 606, 831, 865
DpnI	GATC	3 cut(s)	63, 893, 1131
DpnII	GATC	3 cut(s)	61, 891, 1129
Eam1104I	CTCTTC	2 cut(s)	303, 891
EarI	CTCTTC	2 cut(s)	303, 891
Eco130I	CCWWGG	1 cut(s)	336
Eco47I	GGWCC	1 cut(s)	274
Eco81I	CCTNAGG	1 cut(s)	606
Eco88I	CYCGRG	1 cut(s)	816
EcoO109I	RGGNCCY	1 cut(s)	274
EcoRI	GAATTC	1 cut(s)	173
EcoRII	CCWGG	1 cut(s)	87
EcoT14I	CCWWGG	1 cut(s)	336
ErhI	CCWWGG	1 cut(s)	336
FaeI	CATG	9 cut(s)	62, 130, 424, 491, 533, 843, 850, 982, 1154
FaqI	GGGAC	3 cut(s)	694, 799, 924
FatI	CATG	9 cut(s)	58, 126, 420, 487, 529, 839, 846, 978, 1150
FbaI	TGATCA	1 cut(s)	61
FblI	GTMKAC	1 cut(s)	411
Fnu4HI	GCNGC	3 cut(s)	485, 696, 870
FokI	GGATG	2 cut(s)	724, 937
Fsp4HI	GCNGC	3 cut(s)	485, 696, 870
FspBI	CTAG	4 cut(s)	587, 1101, 1140, 1163
GlaI	GCGC	1 cut(s)	884
GluI	GCNGC	3 cut(s)	485, 696, 870
HhaI	GCGC	1 cut(s)	885
Hin1II	CATG	9 cut(s)	62, 130, 424, 491, 533, 843, 850, 982, 1154
Hin6I	GCGC	1 cut(s)	883
HinP1I	GCGC	1 cut(s)	883
HindIII	AAGCTT	1 cut(s)	632
HinfI	GANTC	6 cut(s)	26, 83, 369, 601, 624, 727
HphI	GGTGA	1 cut(s)	951
Hpy166II	GTNNAC	5 cut(s)	49, 412, 542, 745, 837
Hpy188I	TCNGA	1 cut(s)	677
Hpy188III	TCNNGA	5 cut(s)	245, 437, 587, 816, 979
Hpy8I	GTNNAC	5 cut(s)	49, 412, 542, 745, 837
Hpy99I	CGWCG	1 cut(s)	800
HpyCH4III	ACNGT	2 cut(s)	14, 749
HpyCH4IV	ACGT	1 cut(s)	354
HpyF10VI	GCNNNNNNNGC	1 cut(s)	692
HpyF3I	CTNAG	7 cut(s)	93, 119, 154, 297, 606, 831, 865
HpySE526I	ACGT	1 cut(s)	354
Hsp92II	CATG	9 cut(s)	62, 130, 424, 491, 533, 843, 850, 982, 1154
HspAI	GCGC	1 cut(s)	883
Ksp22I	TGATCA	1 cut(s)	61
Kzo9I	GATC	3 cut(s)	61, 891, 1129
LguI	GCTCTTC	1 cut(s)	303
Lsp1109I	GCAGC	3 cut(s)	471, 707, 881
LweI	GCATC	2 cut(s)	702, 1121
MaeI	CTAG	4 cut(s)	587, 1101, 1140, 1163
MaeII	ACGT	1 cut(s)	354
MaeIII	GTNAC	3 cut(s)	8, 455, 724
MalI	GATC	3 cut(s)	63, 893, 1131
MboI	GATC	3 cut(s)	61, 891, 1129
MboII	GAAGA	5 cut(s)	320, 354, 752, 798, 908
MluCI	AATT	8 cut(s)	65, 165, 173, 670, 802, 1017, 1066, 1155
MlyI	GAGTC	3 cut(s)	363, 618, 721
MmeI	TCCRAC	5 cut(s)	54, 125, 310, 757, 981
MnlI	CCTC	8 cut(s)	416, 526, 638, 671, 915, 984, 997, 1038
MseI	TTAA	2 cut(s)	567, 929
MslI	CAYNNNNRTG	2 cut(s)	735, 1140
MspA1I	CMGCKG	1 cut(s)	686
MspR9I	CCNGG	1 cut(s)	89
Mva1269I	GAATGC	3 cut(s)	663, 948, 955
MvaI	CCWGG	1 cut(s)	89
MwoI	GCNNNNNNNGC	1 cut(s)	692
NdeII	GATC	3 cut(s)	61, 891, 1129
NlaIII	CATG	9 cut(s)	62, 130, 424, 491, 533, 843, 850, 982, 1154
NlaIV	GGNNCC	1 cut(s)	334
NmuCI	GTSAC	2 cut(s)	455, 724
NspI	RCATGY	2 cut(s)	491, 850
OliI	CACNNNNGTG	2 cut(s)	735, 1140
PagI	TCATGA	1 cut(s)	978
PciI	ACATGT	1 cut(s)	846
PciSI	GCTCTTC	1 cut(s)	303
PctI	GAATGC	3 cut(s)	663, 948, 955
PfeI	GAWTC	3 cut(s)	26, 83, 601
PkrI	GCNGC	3 cut(s)	486, 697, 871
PleI	GAGTC	3 cut(s)	363, 618, 721
PpsI	GAGTC	3 cut(s)	363, 618, 721
PpuMI	RGGWCCY	1 cut(s)	274
PscI	ACATGT	1 cut(s)	846
Psp5II	RGGWCCY	1 cut(s)	274
Psp6I	CCWGG	1 cut(s)	87
PspGI	CCWGG	1 cut(s)	87
PspN4I	GGNNCC	1 cut(s)	334
PspPI	GGNCC	1 cut(s)	274
PspPPI	RGGWCCY	1 cut(s)	274
PvuII	CAGCTG	1 cut(s)	686
RsaI	GTAC	5 cut(s)	16, 258, 419, 582, 1105
RsaNI	GTAC	5 cut(s)	15, 257, 418, 581, 1104
RseI	CAYNNNNRTG	2 cut(s)	735, 1140
SapI	GCTCTTC	1 cut(s)	303
SaqAI	TTAA	2 cut(s)	567, 929
SatI	GCNGC	3 cut(s)	485, 696, 870
Sau3AI	GATC	3 cut(s)	61, 891, 1129
Sau96I	GGNCC	1 cut(s)	274
ScaI	AGTACT	1 cut(s)	1105
SchI	GAGTC	3 cut(s)	363, 618, 721
ScrFI	CCNGG	1 cut(s)	89
SfaNI	GCATC	2 cut(s)	702, 1121
SfcI	CTRYAG	1 cut(s)	187
SinI	GGWCC	1 cut(s)	274
SmiMI	CAYNNNNRTG	2 cut(s)	735, 1140
SmlI	CTYRAG	1 cut(s)	52
SmoI	CTYRAG	1 cut(s)	52
SpeI	ACTAGT	1 cut(s)	1100
Sse9I	AATT	8 cut(s)	65, 165, 173, 670, 802, 1017, 1066, 1155
SsiI	CCGC	1 cut(s)	614
SspMI	CTAG	4 cut(s)	587, 1101, 1140, 1163
StyD4I	CCNGG	1 cut(s)	87
StyI	CCWWGG	1 cut(s)	336
TaaI	ACNGT	2 cut(s)	14, 749
TaiI	ACGT	1 cut(s)	357
TaqI	TCGA	5 cut(s)	246, 387, 655, 894, 1170
TasI	AATT	8 cut(s)	65, 165, 173, 670, 802, 1017, 1066, 1155
TatI	WGTACW	4 cut(s)	256, 417, 580, 1103
TfiI	GAWTC	3 cut(s)	26, 83, 601
Tru1I	TTAA	2 cut(s)	567, 929
Tru9I	TTAA	2 cut(s)	567, 929
TscAI	CASTG	3 cut(s)	51, 460, 797
TseFI	GTSAC	2 cut(s)	455, 724
TseI	GCWGC	3 cut(s)	484, 695, 869
Tsp45I	GTSAC	2 cut(s)	455, 724
TspDTI	ATGAA	2 cut(s)	413, 1167
TspRI	CASTG	3 cut(s)	51, 460, 797
VpaK11BI	GGWCC	1 cut(s)	274
XapI	RAATTY	2 cut(s)	173, 1066
XbaI	TCTAGA	1 cut(s)	586
XceI	RCATGY	2 cut(s)	491, 850
XmiI	GTMKAC	1 cut(s)	411
XspI	CTAG	4 cut(s)	587, 1101, 1140, 1163
ZrmI	AGTACT	1 cut(s)	1105

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.