Rmu_sc0017564.1_g000001

Protein kinase domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0017564.1
Physical Location & Seq
Forward (+)
9 .. 869
861 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0017564.1_g000001.1.cds

Sequence Viewer

Length: 861 bp
atggcagaagttggagccttgggaagaacttaccatgtcaatttggttagactctatggcttctgcttcgcccccgaaatgaaagcccttgtctatgagtacatggagaaaggttctcttgacaagttattgttcagtgacaatggagaactagatttagagaagcttcatgttattgcagtccaaactgcaaaagggttggcttatttgcatgaggagtgtgaacaaaagatcattcactatgatattaagcccgaaaatgtgcttctggatgagaacttgaatcccaaggttgcggattttggactcgccaggctttgcaatagagggagtagtcgaatgctcctaactaacttcagagggacagctggatatgcagccccagagatgtggaagccttatcctgtgactcacaaatgtgatgtttacagttttggtattcttctctttgagattgttggaagaagaagacactgcgacgataatgtgagcgagtctcgagactggctacctaagtggacatggaacatgtttgagaaaaatgacttagcagcactattattgggctgtgggattgaagagagagagaggggaaaagcagagaggatgttaatgatagctctgtggtgcattcagcattcaccagaagcaagacctctcatgagcaatgtagtgcaaatgttggaggggcataaagaaattactccacctccttgcccctttgaacatttgcaatctccacaactgaatttcagtcaaaatagtggaacagatgacggcactagtacttcagcatcagccacaatgattgatccccaccccagtgttgcacatgaaattgagcttgttgttgtccaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

286

Amino Acids

32.38

Weight (kDa)

5.48

Isoelectric Point (pI)

43.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 296
AclWI GGATC 1 cut(s) 806
AcsI RAATTY 1 cut(s) 748
AcuI CTGAAG 2 cut(s) 340, 774
AfaI GTAC 2 cut(s) 101, 787
AflIII ACRYGT 1 cut(s) 528
AgsI TTSAA 3 cut(s) 283, 578, 725
AhlI ACTAGT 1 cut(s) 782
AjnI CCWGG 1 cut(s) 311
AleI CACNNNNGTG 2 cut(s) 417, 822
AluBI AGCT 4 cut(s) 166, 368, 620, 844
AluI AGCT 4 cut(s) 166, 368, 620, 844
Alw26I GTCTC 2 cut(s) 495, 501
AlwI GGATC 1 cut(s) 806
Ama87I CYCGRG 1 cut(s) 498
ApeKI GCWGC 2 cut(s) 377, 551
ApoI RAATTY 1 cut(s) 748
AsuHPI GGTGA 1 cut(s) 633
AvaI CYCGRG 1 cut(s) 498
BbsI GAAGAC 1 cut(s) 475
BbvI GCAGC 2 cut(s) 389, 563
BceAI ACGGC 1 cut(s) 793
BciT130I CCWGG 1 cut(s) 313
BcoDI GTCTC 2 cut(s) 495, 501
BcuI ACTAGT 1 cut(s) 782
BfaI CTAG 2 cut(s) 152, 783
BisI GCNGC 2 cut(s) 378, 552
BlsI GCNGC 2 cut(s) 379, 553
BmcAI AGTACT 1 cut(s) 787
Bme1390I CCNGG 1 cut(s) 313
BmeT110I CYCGRG 1 cut(s) 498
BmiI GGNNCC 1 cut(s) 16
BmrFI CCNGG 1 cut(s) 313
BmrI ACTGGG 1 cut(s) 816
BmsI GCATC 1 cut(s) 803
BmuI ACTGGG 1 cut(s) 816
BpiI GAAGAC 1 cut(s) 475
BplI GAGNNNNNCTC 2 cut(s) 481, 513
BsaJI CCNNGG 2 cut(s) 18, 288
BsaXI ACNNNNNCTCC 2 cut(s) 694, 724
Bse1I ACTGG 2 cut(s) 509, 822
Bse3DI GCAATG 1 cut(s) 673
BseBI CCWGG 1 cut(s) 313
BseDI CCNNGG 2 cut(s) 18, 288
BseGI GGATG 2 cut(s) 277, 612
BseMI GCAATG 1 cut(s) 673
BseNI ACTGG 2 cut(s) 509, 822
BseRI GAGGAG 1 cut(s) 230
BseXI GCAGC 2 cut(s) 389, 563
BsiHKCI CYCGRG 1 cut(s) 498
BslFI GGGAC 1 cut(s) 376
BsmAI GTCTC 2 cut(s) 495, 501
BsmFI GGGAC 1 cut(s) 376
BsmI GAATGC 3 cut(s) 345, 630, 637
BsoBI CYCGRG 1 cut(s) 498
Bsp143I GATC 2 cut(s) 231, 811
BspACI CCGC 1 cut(s) 296
BspHI TCATGA 1 cut(s) 660
BspLI GGNNCC 1 cut(s) 16
BspPI GGATC 1 cut(s) 806
BsrDI GCAATG 1 cut(s) 673
BsrI ACTGG 2 cut(s) 509, 822
BssECI CCNNGG 2 cut(s) 18, 288
BssMI GATC 2 cut(s) 231, 811
BssT1I CCWWGG 2 cut(s) 18, 288
Bst2UI CCWGG 1 cut(s) 313
Bst4CI ACNGT 1 cut(s) 431
Bst6I CTCTTC 1 cut(s) 573
BstDEI CTNAG 2 cut(s) 513, 547
BstF5I GGATG 2 cut(s) 277, 612
BstKTI GATC 2 cut(s) 234, 814
BstMAI GTCTC 2 cut(s) 495, 501
BstMBI GATC 2 cut(s) 231, 811
BstMWI GCNNNNNNNGC 1 cut(s) 374
BstNI CCWGG 1 cut(s) 313
BstNSI RCATGY 1 cut(s) 532
BstSCI CCNGG 1 cut(s) 311
BstV1I GCAGC 2 cut(s) 389, 563
BstV2I GAAGAC 1 cut(s) 475
BstXI CCANNNNNNTGG 1 cut(s) 390
BtsCI GGATG 2 cut(s) 277, 612
BtsI GCAGTG 1 cut(s) 472
BtsIMutI CAGTG 3 cut(s) 142, 472, 829
CciI TCATGA 1 cut(s) 660
Csp6I GTAC 2 cut(s) 100, 786
CspCI CAANNNNNGTGG 2 cut(s) 790, 825
CviAII CATG 8 cut(s) 35, 103, 170, 212, 522, 529, 661, 833
CviQI GTAC 2 cut(s) 100, 786
DdeI CTNAG 2 cut(s) 513, 547
DpnI GATC 2 cut(s) 233, 813
DpnII GATC 2 cut(s) 231, 811
Eam1104I CTCTTC 1 cut(s) 573
EarI CTCTTC 1 cut(s) 573
Eco130I CCWWGG 2 cut(s) 18, 288
Eco57I CTGAAG 2 cut(s) 340, 774
Eco88I CYCGRG 1 cut(s) 498
EcoRII CCWGG 1 cut(s) 311
EcoT14I CCWWGG 2 cut(s) 18, 288
ErhI CCWWGG 2 cut(s) 18, 288
FaeI CATG 8 cut(s) 38, 106, 173, 215, 525, 532, 664, 836
FalI AAGNNNNNCTT 2 cut(s) 102, 134
FaqI GGGAC 1 cut(s) 376
FatI CATG 8 cut(s) 34, 102, 169, 211, 521, 528, 660, 832
Fnu4HI GCNGC 2 cut(s) 378, 552
FokI GGATG 2 cut(s) 284, 619
Fsp4HI GCNGC 2 cut(s) 378, 552
FspBI CTAG 2 cut(s) 152, 783
GluI GCNGC 2 cut(s) 378, 552
Hin1II CATG 8 cut(s) 38, 106, 173, 215, 525, 532, 664, 836
HindIII AAGCTT 1 cut(s) 164
HinfI GANTC 5 cut(s) 51, 283, 306, 409, 494
HphI GGTGA 1 cut(s) 633
Hpy166II GTNNAC 3 cut(s) 224, 427, 519
Hpy188I TCNGA 1 cut(s) 359
Hpy188III TCNNGA 5 cut(s) 119, 269, 498, 500, 661
Hpy8I GTNNAC 3 cut(s) 224, 427, 519
Hpy99I CGWCG 1 cut(s) 482
HpyCH4III ACNGT 1 cut(s) 431
HpyCH4V TGCA 9 cut(s) 179, 191, 211, 321, 377, 630, 676, 733, 830
HpyF10VI GCNNNNNNNGC 1 cut(s) 374
HpyF3I CTNAG 2 cut(s) 513, 547
Hsp92II CATG 8 cut(s) 38, 106, 173, 215, 525, 532, 664, 836
Kzo9I GATC 2 cut(s) 231, 811
LmnI GCTCC 2 cut(s) 14, 348
LpnPI CCDG 9 cut(s) 254, 298, 325, 354, 396, 417, 490, 657, 835
Lsp1109I GCAGC 2 cut(s) 389, 563
LweI GCATC 1 cut(s) 803
MaeI CTAG 2 cut(s) 152, 783
MaeIII GTNAC 2 cut(s) 137, 406
MalI GATC 2 cut(s) 233, 813
MboI GATC 2 cut(s) 231, 811
MboII GAAGA 6 cut(s) 36, 434, 474, 477, 480, 590
MluCI AATT 4 cut(s) 40, 699, 748, 837
MlyI GAGTC 4 cut(s) 45, 300, 403, 503
MmeI TCCRAC 2 cut(s) 439, 663
MnlI CCTC 8 cut(s) 208, 320, 353, 582, 597, 666, 679, 720
MseI TTAA 2 cut(s) 249, 611
MslI CAYNNNNRTG 2 cut(s) 417, 822
MspA1I CMGCKG 1 cut(s) 368
MspR9I CCNGG 1 cut(s) 313
Mva1269I GAATGC 3 cut(s) 345, 630, 637
MvaI CCWGG 1 cut(s) 313
MwoI GCNNNNNNNGC 1 cut(s) 374
NdeII GATC 2 cut(s) 231, 811
NlaIII CATG 8 cut(s) 38, 106, 173, 215, 525, 532, 664, 836
NlaIV GGNNCC 1 cut(s) 16
NmuCI GTSAC 2 cut(s) 137, 406
NspI RCATGY 1 cut(s) 532
OliI CACNNNNGTG 2 cut(s) 417, 822
PaeR7I CTCGAG 1 cut(s) 498
PagI TCATGA 1 cut(s) 660
PciI ACATGT 1 cut(s) 528
PctI GAATGC 3 cut(s) 345, 630, 637
PfeI GAWTC 1 cut(s) 283
PkrI GCNGC 2 cut(s) 379, 553
PleI GAGTC 4 cut(s) 45, 300, 403, 502
PpsI GAGTC 4 cut(s) 45, 300, 403, 502
PscI ACATGT 1 cut(s) 528
Psp6I CCWGG 1 cut(s) 311
PspGI CCWGG 1 cut(s) 311
PspN4I GGNNCC 1 cut(s) 16
PvuII CAGCTG 1 cut(s) 368
RsaI GTAC 2 cut(s) 101, 787
RsaNI GTAC 2 cut(s) 100, 786
RseI CAYNNNNRTG 2 cut(s) 417, 822
SaqAI TTAA 2 cut(s) 249, 611
SatI GCNGC 2 cut(s) 378, 552
Sau3AI GATC 2 cut(s) 231, 811
ScaI AGTACT 1 cut(s) 787
SchI GAGTC 4 cut(s) 45, 300, 403, 503
ScrFI CCNGG 1 cut(s) 313
SetI ASST 9 cut(s) 115, 168, 294, 370, 514, 622, 658, 712, 846
SfaNI GCATC 1 cut(s) 803
Sfr274I CTCGAG 1 cut(s) 498
SlaI CTCGAG 1 cut(s) 498
SmiMI CAYNNNNRTG 2 cut(s) 417, 822
SmlI CTYRAG 1 cut(s) 498
SmoI CTYRAG 1 cut(s) 498
SpeI ACTAGT 1 cut(s) 782
Sse9I AATT 4 cut(s) 40, 699, 748, 837
SsiI CCGC 1 cut(s) 296
SspMI CTAG 2 cut(s) 152, 783
StyD4I CCNGG 1 cut(s) 311
StyI CCWWGG 2 cut(s) 18, 288
TaaI ACNGT 1 cut(s) 431
TaqI TCGA 2 cut(s) 337, 499
TasI AATT 4 cut(s) 40, 699, 748, 837
TatI WGTACW 2 cut(s) 99, 785
TfiI GAWTC 1 cut(s) 283
Tru1I TTAA 2 cut(s) 249, 611
Tru9I TTAA 2 cut(s) 249, 611
TscAI CASTG 3 cut(s) 142, 479, 829
TseFI GTSAC 2 cut(s) 137, 406
TseI GCWGC 2 cut(s) 377, 551
Tsp45I GTSAC 2 cut(s) 137, 406
TspDTI ATGAA 3 cut(s) 95, 158, 849
TspRI CASTG 3 cut(s) 142, 479, 829
XapI RAATTY 1 cut(s) 748
XceI RCATGY 1 cut(s) 532
XhoI CTCGAG 1 cut(s) 498
XspI CTAG 2 cut(s) 152, 783
ZrmI AGTACT 1 cut(s) 787
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.