Rmu_sc0004219.1_g000003

Glycosyl hydrolases family 28

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004219.1
Physical Location & Seq
Forward (+)
14785 .. 15506
722 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004219.1_g000003.1.cds

Sequence Viewer

Length: 495 bp
atgtgtggtccaggccatggtataagtgttggaagtcttggtaagcaaggttcttatagcacagtggaagatgtgcaagtgagaaactgcaccttcaacggaacacaaaatggagcaagaatcaagacatggcaaggcgggtcagggtatgctaggaacatcagttttgaggatatcataattcaagcagccaagaaccctatcattatagaccagaagtatactgataatctctctactggaactggaactggaaccctgcttgaccaagaaaatgctgtacaagtgagcgatgtgacattccgtaacattcggggatctgttgctggggatacagccattactttggactgtgaccatcaaattggttgcaaaaacattgtaatggatcacatagacttaacttcatctgttcctggcaagaaggtttctgcccactgcgagaacgttaaaggattatctactttattatctcccagtgtgtcatgtctttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

164

Amino Acids

17.3

Weight (kDa)

6.03

Isoelectric Point (pI)

27.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 17
AccI GTMKAC 1 cut(s) 221
AciI CCGC 1 cut(s) 138
AclI AACGTT 1 cut(s) 447
AclWI GGATC 2 cut(s) 325, 396
AfaI GTAC 1 cut(s) 282
AfiI CCNNNNNNNGG 1 cut(s) 17
AgsI TTSAA 2 cut(s) 97, 185
AjnI CCWGG 2 cut(s) 10, 415
AlwI GGATC 2 cut(s) 325, 396
AoxI GGCC 1 cut(s) 13
ApeKI GCWGC 1 cut(s) 188
AspS9I GGNCC 1 cut(s) 8
AvaII GGWCC 1 cut(s) 8
BbvI GCAGC 1 cut(s) 200
BccI CCATC 1 cut(s) 366
BciT130I CCWGG 2 cut(s) 12, 417
BciVI GTATCC 1 cut(s) 325
BfaI CTAG 1 cut(s) 153
BfuI GTATCC 1 cut(s) 325
BisI GCNGC 1 cut(s) 189
BlsI GCNGC 1 cut(s) 190
Bme1390I CCNGG 2 cut(s) 12, 417
Bme18I GGWCC 1 cut(s) 8
BmgT120I GGNCC 1 cut(s) 8
BmiI GGNNCC 1 cut(s) 256
BmrFI CCNGG 2 cut(s) 12, 417
BmrI ACTGGG 1 cut(s) 471
BmuI ACTGGG 1 cut(s) 471
BsaJI CCNNGG 1 cut(s) 16
Bsc4I CCNNNNNNNGG 1 cut(s) 17
Bse1I ACTGG 4 cut(s) 244, 250, 256, 477
BseBI CCWGG 2 cut(s) 12, 417
BseDI CCNNGG 1 cut(s) 16
BseLI CCNNNNNNNGG 1 cut(s) 17
BseNI ACTGG 4 cut(s) 244, 250, 256, 477
BseXI GCAGC 1 cut(s) 200
BseYI CCCAGC 1 cut(s) 326
BsgI GTGCAG 1 cut(s) 73
BshFI GGCC 1 cut(s) 15
BslI CCNNNNNNNGG 1 cut(s) 17
BsnI GGCC 1 cut(s) 15
Bsp1407I TGTACA 1 cut(s) 280
Bsp143I GATC 2 cut(s) 317, 388
Bsp19I CCATGG 1 cut(s) 16
BspACI CCGC 1 cut(s) 138
BspANI GGCC 1 cut(s) 15
BspLI GGNNCC 1 cut(s) 256
BspPI GGATC 2 cut(s) 325, 396
BsrGI TGTACA 1 cut(s) 280
BsrI ACTGG 4 cut(s) 244, 250, 256, 477
BssECI CCNNGG 1 cut(s) 16
BssMI GATC 2 cut(s) 317, 388
BssNAI GTATAC 1 cut(s) 222
BssT1I CCWWGG 1 cut(s) 16
Bst1107I GTATAC 1 cut(s) 222
Bst2UI CCWGG 2 cut(s) 12, 417
Bst4CI ACNGT 2 cut(s) 64, 353
BstAUI TGTACA 1 cut(s) 280
BstDSI CCRYGG 1 cut(s) 16
BstKTI GATC 2 cut(s) 320, 391
BstMBI GATC 2 cut(s) 317, 388
BstNI CCWGG 2 cut(s) 12, 417
BstSCI CCNGG 2 cut(s) 10, 415
BstV1I GCAGC 1 cut(s) 200
BstX2I RGATCY 1 cut(s) 317
BstXI CCANNNNNNTGG 2 cut(s) 346, 365
BstYI RGATCY 1 cut(s) 317
BstZ17I GTATAC 1 cut(s) 222
BsuI GTATCC 1 cut(s) 325
BsuRI GGCC 1 cut(s) 15
BtgI CCRYGG 1 cut(s) 16
BtgZI GCGATG 1 cut(s) 306
BtsI GCAGTG 1 cut(s) 436
BtsIMutI CAGTG 3 cut(s) 69, 436, 484
Cfr13I GGNCC 1 cut(s) 8
Csp6I GTAC 1 cut(s) 281
CviAII CATG 3 cut(s) 17, 129, 486
CviJI RGCY 3 cut(s) 15, 191, 338
CviKI_1 RGCY 3 cut(s) 15, 191, 338
CviQI GTAC 1 cut(s) 281
DpnI GATC 2 cut(s) 319, 390
DpnII GATC 2 cut(s) 317, 388
Eco130I CCWWGG 1 cut(s) 16
Eco32I GATATC 1 cut(s) 175
Eco47I GGWCC 1 cut(s) 8
EcoRII CCWGG 2 cut(s) 10, 415
EcoRV GATATC 1 cut(s) 175
EcoT14I CCWWGG 1 cut(s) 16
ErhI CCWWGG 1 cut(s) 16
FaeI CATG 3 cut(s) 20, 132, 489
FatI CATG 3 cut(s) 16, 128, 485
FauI CCCGC 1 cut(s) 131
FblI GTMKAC 1 cut(s) 221
Fnu4HI GCNGC 1 cut(s) 189
Fsp4HI GCNGC 1 cut(s) 189
FspBI CTAG 1 cut(s) 153
GluI GCNGC 1 cut(s) 189
GsaI CCCAGC 1 cut(s) 330
HaeIII GGCC 1 cut(s) 15
Hin1II CATG 3 cut(s) 20, 132, 489
HinfI GANTC 1 cut(s) 120
Hpy166II GTNNAC 1 cut(s) 222
Hpy188III TCNNGA 1 cut(s) 124
Hpy8I GTNNAC 1 cut(s) 222
HpyAV CCTTC 2 cut(s) 103, 418
HpyCH4III ACNGT 2 cut(s) 64, 353
HpyCH4IV ACGT 1 cut(s) 447
HpyCH4V TGCA 3 cut(s) 76, 90, 372
HpySE526I ACGT 1 cut(s) 447
Hsp92II CATG 3 cut(s) 20, 132, 489
Kzo9I GATC 2 cut(s) 317, 388
LmnI GCTCC 1 cut(s) 113
Lsp1109I GCAGC 1 cut(s) 200
MaeI CTAG 1 cut(s) 153
MaeII ACGT 1 cut(s) 447
MaeIII GTNAC 3 cut(s) 295, 305, 353
MalI GATC 2 cut(s) 319, 390
MboI GATC 2 cut(s) 317, 388
MboII GAAGA 1 cut(s) 80
MflI RGATCY 1 cut(s) 317
MluCI AATT 2 cut(s) 180, 363
MmeI TCCRAC 1 cut(s) 10
MnlI CCTC 1 cut(s) 163
MseI TTAA 3 cut(s) 401, 450, 493
MslI CAYNNNNRTG 1 cut(s) 383
MspR9I CCNGG 2 cut(s) 12, 417
MvaI CCWGG 2 cut(s) 12, 417
NcoI CCATGG 1 cut(s) 16
NdeII GATC 2 cut(s) 317, 388
NlaIII CATG 3 cut(s) 20, 132, 489
NlaIV GGNNCC 1 cut(s) 256
NmuCI GTSAC 2 cut(s) 295, 353
PfeI GAWTC 1 cut(s) 120
PflMI CCANNNNNTGG 1 cut(s) 17
PkrI GCNGC 1 cut(s) 190
Psp1406I AACGTT 1 cut(s) 447
Psp6I CCWGG 2 cut(s) 10, 415
PspFI CCCAGC 1 cut(s) 326
PspGI CCWGG 2 cut(s) 10, 415
PspN4I GGNNCC 1 cut(s) 256
PspPI GGNCC 1 cut(s) 8
PsrI GAACNNNNNNTAC 2 cut(s) 34, 66
PsuI RGATCY 1 cut(s) 317
RsaI GTAC 1 cut(s) 282
RsaNI GTAC 1 cut(s) 281
RseI CAYNNNNRTG 1 cut(s) 383
SaqAI TTAA 3 cut(s) 401, 450, 493
SatI GCNGC 1 cut(s) 189
Sau3AI GATC 2 cut(s) 317, 388
Sau96I GGNCC 1 cut(s) 8
ScrFI CCNGG 2 cut(s) 12, 417
SetI ASST 4 cut(s) 52, 95, 429, 450
SinI GGWCC 1 cut(s) 8
SmiMI CAYNNNNRTG 1 cut(s) 383
Sse9I AATT 2 cut(s) 180, 363
SsiI CCGC 1 cut(s) 138
SspMI CTAG 1 cut(s) 153
StyD4I CCNGG 2 cut(s) 10, 415
StyI CCWWGG 1 cut(s) 16
TaaI ACNGT 2 cut(s) 64, 353
TaiI ACGT 1 cut(s) 450
TasI AATT 2 cut(s) 180, 363
TatI WGTACW 1 cut(s) 280
TfiI GAWTC 1 cut(s) 120
Tru1I TTAA 3 cut(s) 401, 450, 493
Tru9I TTAA 3 cut(s) 401, 450, 493
TscAI CASTG 3 cut(s) 69, 443, 484
TseFI GTSAC 2 cut(s) 295, 353
TseI GCWGC 1 cut(s) 188
Tsp45I GTSAC 2 cut(s) 295, 353
TspDTI ATGAA 1 cut(s) 396
TspGWI ACGGA 2 cut(s) 114, 293
TspRI CASTG 3 cut(s) 69, 443, 484
Van91I CCANNNNNTGG 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 8
XmiI GTMKAC 1 cut(s) 221
XspI CTAG 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.