Rroxscaffold_2G00148230

Glycosyl hydrolases family 28

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0002703
Physical Location & Seq
Forward (+)
85900569 .. 85902650
2082 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00148230.1

Sequence Viewer

Length: 495 bp
ATGTTGTGTGGTCCAGGCCATGGTATAAGTGTTGGAAGTCTTGGTGAGCATGGTTCTTATAGCATAGTGGAAGATGTGCAAGTGAGAAATGAGTTCACCTTCAAGGAAACACAAAATGGAGTAAGAATTAAGACATGGCAAGGTCGATCAGGGTATGCTAGGCATATTATTTTTGAGAATATCAAAATTCAAGCAGCCAAGAACCCTATCATTATAGACAAGAAGTATTTTGACGATCTCTTTACTAGATTTGGAACTTTGCTTGACCAAGGAAAAGCCATACAAGTGAGCGATATGACGTTCCATAACATTTTGAGATCTGTTGTTGGGGATATAGCCATTTCTTTGGACTGTGACTATCAAATTGGTTGCAAAAATATTGTAATGGATCACATCGACTTAACTTCATCTATTCCTGGCAAGAAGATTTCTACCTCCTGCAAGAACGTCCAAGGATTATCTACTTCATTATCTCCTAGTGTGCCATGCCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00040 ko01100 map00040 map01100
Pfam Domains
Protein Families
Glyco_hydro_28

Protein Analysis

164

Amino Acids

18.05

Weight (kDa)

7.66

Isoelectric Point (pI)

35.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_28 PF00295 2 - 151 3.1e-35 Glycosyl hydrolases family 28
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 20
AclWI GGATC 1 cut(s) 396
AcsI RAATTY 1 cut(s) 186
AfiI CCNNNNNNNGG 1 cut(s) 20
AgsI TTSAA 2 cut(s) 103, 191
AjnI CCWGG 2 cut(s) 13, 415
AlwI GGATC 1 cut(s) 396
AoxI GGCC 1 cut(s) 16
ApeKI GCWGC 1 cut(s) 194
ApoI RAATTY 1 cut(s) 186
AspS9I GGNCC 1 cut(s) 11
AsuHPI GGTGA 2 cut(s) 56, 88
AvaII GGWCC 1 cut(s) 11
BbvI GCAGC 1 cut(s) 206
BciT130I CCWGG 2 cut(s) 15, 417
BfaI CTAG 3 cut(s) 159, 246, 477
BglII AGATCT 1 cut(s) 317
BisI GCNGC 1 cut(s) 195
BlsI GCNGC 1 cut(s) 196
Bme1390I CCNGG 2 cut(s) 15, 417
Bme18I GGWCC 1 cut(s) 11
BmgT120I GGNCC 1 cut(s) 11
BmrFI CCNGG 2 cut(s) 15, 417
BsaJI CCNNGG 3 cut(s) 19, 268, 451
Bsc4I CCNNNNNNNGG 1 cut(s) 20
BseBI CCWGG 2 cut(s) 15, 417
BseDI CCNNGG 3 cut(s) 19, 268, 451
BseLI CCNNNNNNNGG 1 cut(s) 20
BseXI GCAGC 1 cut(s) 206
BshFI GGCC 1 cut(s) 18
BslI CCNNNNNNNGG 1 cut(s) 20
BsnI GGCC 1 cut(s) 18
Bsp143I GATC 4 cut(s) 146, 235, 317, 388
Bsp19I CCATGG 1 cut(s) 19
BspANI GGCC 1 cut(s) 18
BspPI GGATC 1 cut(s) 396
BssECI CCNNGG 3 cut(s) 19, 268, 451
BssMI GATC 4 cut(s) 146, 235, 317, 388
BssT1I CCWWGG 3 cut(s) 19, 268, 451
Bst2UI CCWGG 2 cut(s) 15, 417
Bst4CI ACNGT 1 cut(s) 353
BstDSI CCRYGG 1 cut(s) 19
BstKTI GATC 4 cut(s) 149, 238, 320, 391
BstMBI GATC 4 cut(s) 146, 235, 317, 388
BstNI CCWGG 2 cut(s) 15, 417
BstSCI CCNGG 2 cut(s) 13, 415
BstV1I GCAGC 1 cut(s) 206
BstX2I RGATCY 1 cut(s) 317
BstXI CCANNNNNNTGG 1 cut(s) 346
BstYI RGATCY 1 cut(s) 317
BsuRI GGCC 1 cut(s) 18
BtgI CCRYGG 1 cut(s) 19
Cfr13I GGNCC 1 cut(s) 11
CviAII CATG 4 cut(s) 20, 50, 135, 486
CviJI RGCY 4 cut(s) 18, 197, 278, 338
CviKI_1 RGCY 4 cut(s) 18, 197, 278, 338
DpnI GATC 4 cut(s) 148, 237, 319, 390
DpnII GATC 4 cut(s) 146, 235, 317, 388
Eco130I CCWWGG 3 cut(s) 19, 268, 451
Eco47I GGWCC 1 cut(s) 11
EcoRII CCWGG 2 cut(s) 13, 415
EcoT14I CCWWGG 3 cut(s) 19, 268, 451
ErhI CCWWGG 3 cut(s) 19, 268, 451
FaeI CATG 4 cut(s) 23, 53, 138, 489
FatI CATG 4 cut(s) 19, 49, 134, 485
Fnu4HI GCNGC 1 cut(s) 195
Fsp4HI GCNGC 1 cut(s) 195
FspBI CTAG 3 cut(s) 159, 246, 477
GluI GCNGC 1 cut(s) 195
HaeIII GGCC 1 cut(s) 18
Hin1II CATG 4 cut(s) 23, 53, 138, 489
HphI GGTGA 2 cut(s) 56, 88
Hpy166II GTNNAC 1 cut(s) 96
Hpy8I GTNNAC 1 cut(s) 96
HpyAV CCTTC 1 cut(s) 109
HpyCH4III ACNGT 1 cut(s) 353
HpyCH4IV ACGT 2 cut(s) 299, 447
HpyCH4V TGCA 3 cut(s) 79, 372, 441
HpySE526I ACGT 2 cut(s) 299, 447
Hsp92II CATG 4 cut(s) 23, 53, 138, 489
Kzo9I GATC 4 cut(s) 146, 235, 317, 388
LpnPI CCDG 5 cut(s) 27, 135, 402, 429, 451
Lsp1109I GCAGC 1 cut(s) 206
MaeI CTAG 3 cut(s) 159, 246, 477
MaeII ACGT 2 cut(s) 299, 447
MaeIII GTNAC 1 cut(s) 353
MalI GATC 4 cut(s) 148, 237, 319, 390
MboI GATC 4 cut(s) 146, 235, 317, 388
MboII GAAGA 2 cut(s) 83, 436
MflI RGATCY 1 cut(s) 317
MluCI AATT 3 cut(s) 126, 186, 363
MmeI TCCRAC 1 cut(s) 13
MnlI CCTC 1 cut(s) 445
MseI TTAA 3 cut(s) 129, 401, 493
MslI CAYNNNNRTG 1 cut(s) 284
MspR9I CCNGG 2 cut(s) 15, 417
MvaI CCWGG 2 cut(s) 15, 417
NcoI CCATGG 1 cut(s) 19
NdeII GATC 4 cut(s) 146, 235, 317, 388
NlaIII CATG 4 cut(s) 23, 53, 138, 489
NmuCI GTSAC 1 cut(s) 353
PflMI CCANNNNNTGG 1 cut(s) 20
PkrI GCNGC 1 cut(s) 196
Psp6I CCWGG 2 cut(s) 13, 415
PspGI CCWGG 2 cut(s) 13, 415
PspPI GGNCC 1 cut(s) 11
PsuI RGATCY 1 cut(s) 317
RseI CAYNNNNRTG 1 cut(s) 284
SaqAI TTAA 3 cut(s) 129, 401, 493
SatI GCNGC 1 cut(s) 195
Sau3AI GATC 4 cut(s) 146, 235, 317, 388
Sau96I GGNCC 1 cut(s) 11
ScrFI CCNGG 2 cut(s) 15, 417
SetI ASST 5 cut(s) 101, 145, 302, 437, 450
SinI GGWCC 1 cut(s) 11
SmiMI CAYNNNNRTG 1 cut(s) 284
Sse9I AATT 3 cut(s) 126, 186, 363
SspI AATATT 1 cut(s) 379
SspMI CTAG 3 cut(s) 159, 246, 477
StyD4I CCNGG 2 cut(s) 13, 415
StyI CCWWGG 3 cut(s) 19, 268, 451
TaaI ACNGT 1 cut(s) 353
TaiI ACGT 2 cut(s) 302, 450
TaqI TCGA 2 cut(s) 145, 396
TasI AATT 3 cut(s) 126, 186, 363
Tru1I TTAA 3 cut(s) 129, 401, 493
Tru9I TTAA 3 cut(s) 129, 401, 493
TseFI GTSAC 1 cut(s) 353
TseI GCWGC 1 cut(s) 194
Tsp45I GTSAC 1 cut(s) 353
TspDTI ATGAA 2 cut(s) 396, 456
Van91I CCANNNNNTGG 1 cut(s) 20
VpaK11BI GGWCC 1 cut(s) 11
XapI RAATTY 1 cut(s) 186
XspI CTAG 3 cut(s) 159, 246, 477
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.