Rh1AG101000

Glycosyl hydrolases family 28

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0002703
Physical Location & Seq
Reverse (-)
17691503 .. 17692785
1283 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG101000.1

Sequence Viewer

Length: 543 bp
ATGGAGGAGGTCAAATTGATGGTCAAGGTGAGGTTTGGTGGAAAGTTTGCGACAATTCAAATTGCCAACGACCAGCATCTTGTTGGAAGTCTTGGTAAGCAAGGTGCTTATAACACAGTGGAAGATGTGCAAGTGAGAAACTGCACCCTGAAGGGAACACAAAATGGAGCAAGAATCAAGACATGGCAAGGCGGGTCAGGGTATGCTAGGAACATCAGTTTTGAGGATATCATAATTCAAGCAGTCAAGAACCCCATCATTATAGACCAGAAGTATATTGATAAGAGCATTGGTGGAACTGGAACCTTGCTTGACCAAGGAAGTGCTGTACAAGTGAGCGATGTGACATTCCGTAACATTCGGGGATCTGTTGCTGGGGAAACAGCCATTACTTTGGACTGTGACGATCAAATTGGTTGCAAAAACATTGTAATGGATAACATAGACTTAACTTCATCTGTTCCTGGCAAGAAGCTTTCTGCACAGTGCAAGAACGTTCAAGGATCTTCTACTTCATTATCTCCTAGTGTGCCATGCCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00040 ko01100 map00040 map01100
Pfam Domains
Protein Families
Glyco_hydro_28

Protein Analysis

180

Amino Acids

19.22

Weight (kDa)

8.26

Isoelectric Point (pI)

27.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_28 PF00295 28 - 168 4.2e-38 Glycosyl hydrolases family 28
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 111
AciI CCGC 1 cut(s) 192
AclI AACGTT 1 cut(s) 495
AclWI GGATC 2 cut(s) 373, 511
AcuI CTGAAG 1 cut(s) 170
AfaI GTAC 1 cut(s) 330
AgsI TTSAA 3 cut(s) 59, 239, 500
AjnI CCWGG 1 cut(s) 463
AluBI AGCT 1 cut(s) 475
AluI AGCT 1 cut(s) 475
AlwI GGATC 2 cut(s) 373, 511
ArsI GACNNNNNNTTYG 1 cut(s) 38
AsuHPI GGTGA 1 cut(s) 40
BccI CCATC 2 cut(s) 13, 263
BciT130I CCWGG 1 cut(s) 465
BfaI CTAG 2 cut(s) 207, 525
Bme1390I CCNGG 1 cut(s) 465
BmiI GGNNCC 1 cut(s) 304
BmrFI CCNGG 1 cut(s) 465
BmsI GCATC 1 cut(s) 85
BsaJI CCNNGG 1 cut(s) 316
Bse1I ACTGG 1 cut(s) 304
BseBI CCWGG 1 cut(s) 465
BseDI CCNNGG 1 cut(s) 316
BseNI ACTGG 1 cut(s) 304
BseRI GAGGAG 1 cut(s) 20
BseYI CCCAGC 1 cut(s) 374
BsgI GTGCAG 2 cut(s) 127, 465
Bsp1407I TGTACA 1 cut(s) 328
Bsp143I GATC 3 cut(s) 365, 406, 503
BspACI CCGC 1 cut(s) 192
BspLI GGNNCC 1 cut(s) 304
BspPI GGATC 2 cut(s) 373, 511
BsrGI TGTACA 1 cut(s) 328
BsrI ACTGG 1 cut(s) 304
BssECI CCNNGG 1 cut(s) 316
BssMI GATC 3 cut(s) 365, 406, 503
BssT1I CCWWGG 1 cut(s) 316
Bst2UI CCWGG 1 cut(s) 465
Bst4CI ACNGT 3 cut(s) 118, 401, 486
BstAUI TGTACA 1 cut(s) 328
BstKTI GATC 3 cut(s) 368, 409, 506
BstMBI GATC 3 cut(s) 365, 406, 503
BstNI CCWGG 1 cut(s) 465
BstSCI CCNGG 1 cut(s) 463
BstX2I RGATCY 2 cut(s) 365, 503
BstXI CCANNNNNNTGG 1 cut(s) 394
BstYI RGATCY 2 cut(s) 365, 503
BtgZI GCGATG 1 cut(s) 354
BtsIMutI CAGTG 2 cut(s) 123, 491
Csp6I GTAC 1 cut(s) 329
CviAII CATG 2 cut(s) 183, 534
CviJI RGCY 2 cut(s) 386, 475
CviKI_1 RGCY 2 cut(s) 386, 475
CviQI GTAC 1 cut(s) 329
DpnI GATC 3 cut(s) 367, 408, 505
DpnII GATC 3 cut(s) 365, 406, 503
Eco130I CCWWGG 1 cut(s) 316
Eco32I GATATC 1 cut(s) 229
Eco57I CTGAAG 1 cut(s) 170
EcoRII CCWGG 1 cut(s) 463
EcoRV GATATC 1 cut(s) 229
EcoT14I CCWWGG 1 cut(s) 316
ErhI CCWWGG 1 cut(s) 316
FaeI CATG 2 cut(s) 186, 537
FaiI YATR 8 cut(s) 111, 184, 204, 233, 263, 276, 443, 535
FatI CATG 2 cut(s) 182, 533
FauI CCCGC 1 cut(s) 185
FspBI CTAG 2 cut(s) 207, 525
GsaI CCCAGC 1 cut(s) 378
Hin1II CATG 2 cut(s) 186, 537
HindIII AAGCTT 1 cut(s) 473
HinfI GANTC 1 cut(s) 174
HphI GGTGA 1 cut(s) 40
Hpy188III TCNNGA 2 cut(s) 178, 247
HpyAV CCTTC 1 cut(s) 145
HpyCH4III ACNGT 3 cut(s) 118, 401, 486
HpyCH4IV ACGT 1 cut(s) 495
HpyCH4V TGCA 5 cut(s) 130, 144, 420, 482, 489
HpySE526I ACGT 1 cut(s) 495
Hsp92II CATG 2 cut(s) 186, 537
Kzo9I GATC 3 cut(s) 365, 406, 503
LmnI GCTCC 1 cut(s) 167
LpnPI CCDG 8 cut(s) 86, 161, 183, 281, 285, 360, 450, 477
LweI GCATC 1 cut(s) 85
MaeI CTAG 2 cut(s) 207, 525
MaeII ACGT 1 cut(s) 495
MaeIII GTNAC 3 cut(s) 343, 353, 401
MalI GATC 3 cut(s) 367, 408, 505
MboI GATC 3 cut(s) 365, 406, 503
MboII GAAGA 2 cut(s) 134, 498
MflI RGATCY 2 cut(s) 365, 503
MluCI AATT 5 cut(s) 14, 54, 60, 234, 411
MmeI TCCRAC 1 cut(s) 64
MnlI CCTC 2 cut(s) 24, 217
MseI TTAA 2 cut(s) 449, 541
MslI CAYNNNNRTG 1 cut(s) 431
MspR9I CCNGG 1 cut(s) 465
MvaI CCWGG 1 cut(s) 465
NdeII GATC 3 cut(s) 365, 406, 503
NlaIII CATG 2 cut(s) 186, 537
NlaIV GGNNCC 1 cut(s) 304
NmuCI GTSAC 2 cut(s) 343, 401
PfeI GAWTC 1 cut(s) 174
PsiI TTATAA 1 cut(s) 111
Psp1406I AACGTT 1 cut(s) 495
Psp6I CCWGG 1 cut(s) 463
PspFI CCCAGC 1 cut(s) 374
PspGI CCWGG 1 cut(s) 463
PspN4I GGNNCC 1 cut(s) 304
PsuI RGATCY 2 cut(s) 365, 503
RsaI GTAC 1 cut(s) 330
RsaNI GTAC 1 cut(s) 329
RseI CAYNNNNRTG 1 cut(s) 431
SaqAI TTAA 2 cut(s) 449, 541
Sau3AI GATC 3 cut(s) 365, 406, 503
ScrFI CCNGG 1 cut(s) 465
SetI ASST 7 cut(s) 12, 30, 35, 106, 308, 477, 498
SfaNI GCATC 1 cut(s) 85
SmiMI CAYNNNNRTG 1 cut(s) 431
Sse9I AATT 5 cut(s) 14, 54, 60, 234, 411
SsiI CCGC 1 cut(s) 192
SspMI CTAG 2 cut(s) 207, 525
StyD4I CCNGG 1 cut(s) 463
StyI CCWWGG 1 cut(s) 316
TaaI ACNGT 3 cut(s) 118, 401, 486
TaiI ACGT 1 cut(s) 498
TasI AATT 5 cut(s) 14, 54, 60, 234, 411
TatI WGTACW 1 cut(s) 328
TfiI GAWTC 1 cut(s) 174
Tru1I TTAA 2 cut(s) 449, 541
Tru9I TTAA 2 cut(s) 449, 541
TscAI CASTG 2 cut(s) 123, 491
TseFI GTSAC 2 cut(s) 343, 401
Tsp45I GTSAC 2 cut(s) 343, 401
TspDTI ATGAA 2 cut(s) 444, 504
TspGWI ACGGA 1 cut(s) 341
TspRI CASTG 2 cut(s) 123, 491
XcmI CCANNNNNNNNNTGG 1 cut(s) 80
XspI CTAG 2 cut(s) 207, 525
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.