Rmu_sc0004759.1_g000016

isoform X1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004759.1
OG0000995
Physical Location & Seq
Forward (+)
68494 .. 70728
2235 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004759.1_g000016.1.cds

Sequence Viewer

Length: 1335 bp
atgaaactcgagagggaaccggtgtttggccaattaagtttaagccacaagcctgattataaaccttttgatcacaatgagattactctgaattctgggggattacaatcagcaaattggattgggaaggaaagtcagaccagggttttgtttgattcgaaggacaatgaggaagatgctgttcaaaatgatggaattgacttgactgcatcaagatttgattgttcaaagagtgtggatgatttggaaacctgtaatgaaggtgaagttaaaggttttgcgcctgaaaaattagaatctttagggaagcaatcagaatattatatggacaaaagtgttacagaatgcgacttgccagaactgacagtttgttacaaagagagtagttgcaacaccatcaaggatatctgcatagatgagggagtgccttcccaagagaagatccggtttgagacagacgtggatgagaaggcattttgcacttatttgtctcccgataaggatcagaaacacttactgcttgaacaacaaatggacatttttatgaccattccagatgatttcaagtcttctgcacagaaatatgatgtaaagaaggattttgtcattgcttgtgatgccaaggatctggtgcagagagaagaagcaatgtatgatgcatcagagaaaactgcaattgatgtgtccagagacatgatttcccttgaaaacttgcgaacacagaatttgaactccaagtcctctagtaaggccagcaatgaagctgtacaagatactgttcagatatcgagtgacaaggaaagtgaaatagcagaaactcacagcagtgctttggtttcagcaaaggaagaatctaaggatattgagaatggagcgttcttgaagcgagatcctgttccttcagctgtagaactaaactgccatgttgataagttatctgacattagtgaagtggagaatggaagcattactgttggtttggaccgttcagcacctgtatctaccttctggctcaattggaatgcctggattgctgctaatcttctccaaaaaggatgtaaatggctttcctttgactggaatgaattcttcatcgtttatgccactgagatttctattgcttccaagcctagtattgataataggcctcgtcagtttgtaaaccttcaatggatgaaacctgctgcaaacaatttcaaattgaacattgatggttccagatcttatgcaggagtgattggagctggtggtctcattaggaacagttctggtgtttggattaaagggttcactcatagtatgggagttggtgagattgtcgaagctgaagcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

444

Amino Acids

49.57

Weight (kDa)

4.64

Isoelectric Point (pI)

47.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 60
Acc36I ACCTGC 1 cut(s) 1189
AclWI GGATC 4 cut(s) 436, 510, 633, 884
AcoI YGGCCR 1 cut(s) 28
AcsI RAATTY 3 cut(s) 91, 724, 1085
AcuI CTGAAG 1 cut(s) 885
AfaI GTAC 1 cut(s) 768
AfiI CCNNNNNNNGG 2 cut(s) 26, 1077
AgeI ACCGGT 1 cut(s) 19
AjiI CACGTC 1 cut(s) 460
AjnI CCWGG 2 cut(s) 140, 1025
AjuI GAANNNNNNNTTGG 2 cut(s) 9, 41
AleI CACNNNNGTG 1 cut(s) 825
AloI GAACNNNNNNTCC 2 cut(s) 722, 754
AluBI AGCT 5 cut(s) 764, 905, 1244, 1325, 1331
AluI AGCT 5 cut(s) 764, 905, 1244, 1325, 1331
Alw26I GTCTC 4 cut(s) 446, 495, 684, 1256
AlwI GGATC 4 cut(s) 436, 510, 633, 884
AlwNI CAGNNNCTG 1 cut(s) 995
Ama87I CYCGRG 1 cut(s) 8
AoxI GGCC 3 cut(s) 28, 750, 1145
ApeKI GCWGC 2 cut(s) 1034, 1184
ApoI RAATTY 3 cut(s) 91, 724, 1085
ArsI GACNNNNNNTTYG 2 cut(s) 130, 162
AsiGI ACCGGT 1 cut(s) 19
Asp700I GAANNNNTTC 1 cut(s) 1085
AspLEI GCGC 1 cut(s) 283
AspS9I GGNCC 1 cut(s) 982
AsuHPI GGTGA 2 cut(s) 275, 1322
AsuII TTCGAA 1 cut(s) 158
AvaI CYCGRG 1 cut(s) 8
AvaII GGWCC 1 cut(s) 982
BalI TGGCCA 1 cut(s) 30
BbsI GAAGAC 1 cut(s) 561
BbvI GCAGC 2 cut(s) 1021, 1171
BccI CCATC 3 cut(s) 185, 404, 1205
BciT130I CCWGG 2 cut(s) 142, 1027
BclI TGATCA 1 cut(s) 70
BcoDI GTCTC 4 cut(s) 446, 495, 684, 1256
BfaI CTAG 2 cut(s) 744, 1131
BfmI CTRYAG 1 cut(s) 906
BfuAI ACCTGC 1 cut(s) 1189
BglII AGATCT 1 cut(s) 1220
BisI GCNGC 2 cut(s) 1035, 1185
BlsI GCNGC 2 cut(s) 1036, 1186
Bme1390I CCNGG 2 cut(s) 142, 1027
Bme18I GGWCC 1 cut(s) 982
BmeT110I CYCGRG 1 cut(s) 8
BmgBI CACGTC 1 cut(s) 460
BmgT120I GGNCC 1 cut(s) 982
BmiI GGNNCC 2 cut(s) 18, 1216
BmrFI CCNGG 2 cut(s) 142, 1027
BmsI GCATC 5 cut(s) 166, 218, 607, 646, 668
BpiI GAAGAC 1 cut(s) 561
Bpu14I TTCGAA 1 cut(s) 158
BsaBI GATNNNNATC 2 cut(s) 106, 501
BsaI GGTCTC 1 cut(s) 1256
BsaJI CCNNGG 2 cut(s) 141, 621
BsaWI WCCGGW 2 cut(s) 19, 444
Bsc4I CCNNNNNNNGG 2 cut(s) 26, 1077
Bse118I RCCGGY 1 cut(s) 19
Bse1I ACTGG 1 cut(s) 1082
Bse3DI GCAATG 3 cut(s) 606, 654, 763
Bse8I GATNNNNATC 2 cut(s) 106, 501
BseBI CCWGG 2 cut(s) 142, 1027
BseDI CCNNGG 2 cut(s) 141, 621
BseGI GGATG 4 cut(s) 244, 469, 1061, 1179
BseJI GATNNNNATC 2 cut(s) 106, 501
BseLI CCNNNNNNNGG 2 cut(s) 26, 1077
BseMI GCAATG 3 cut(s) 606, 654, 763
BseMII CTCAG 1 cut(s) 1098
BseNI ACTGG 1 cut(s) 1082
BseXI GCAGC 2 cut(s) 1021, 1171
BsgI GTGCAG 2 cut(s) 558, 653
BshFI GGCC 3 cut(s) 30, 752, 1147
BshTI ACCGGT 1 cut(s) 19
BsiHKCI CYCGRG 1 cut(s) 8
BsiSI CCGG 2 cut(s) 20, 445
BslI CCNNNNNNNGG 2 cut(s) 26, 1077
BsmAI GTCTC 4 cut(s) 446, 495, 684, 1256
BsmI GAATGC 2 cut(s) 350, 1027
BsnI GGCC 3 cut(s) 30, 752, 1147
Bso31I GGTCTC 1 cut(s) 1256
BsoBI CYCGRG 1 cut(s) 8
Bsp119I TTCGAA 1 cut(s) 158
Bsp1407I TGTACA 1 cut(s) 766
Bsp143I GATC 6 cut(s) 70, 441, 502, 625, 889, 1220
BspANI GGCC 3 cut(s) 30, 752, 1147
BspCNI CTCAG 1 cut(s) 1099
BspLI GGNNCC 2 cut(s) 18, 1216
BspMI ACCTGC 1 cut(s) 1189
BspPI GGATC 4 cut(s) 436, 510, 633, 884
BspT104I TTCGAA 1 cut(s) 158
BspTNI GGTCTC 1 cut(s) 1256
BsrDI GCAATG 3 cut(s) 606, 654, 763
BsrFI RCCGGY 1 cut(s) 19
BsrGI TGTACA 1 cut(s) 766
BsrI ACTGG 1 cut(s) 1082
BssAI RCCGGY 1 cut(s) 19
BssECI CCNNGG 2 cut(s) 141, 621
BssMI GATC 6 cut(s) 70, 441, 502, 625, 889, 1220
BssT1I CCWWGG 1 cut(s) 621
Bst2UI CCWGG 2 cut(s) 142, 1027
Bst4CI ACNGT 5 cut(s) 367, 778, 973, 986, 1265
BstAUI TGTACA 1 cut(s) 766
BstBI TTCGAA 1 cut(s) 158
BstC8I GCNNGC 1 cut(s) 754
BstDEI CTNAG 2 cut(s) 855, 1107
BstF5I GGATG 4 cut(s) 244, 469, 1061, 1179
BstHHI GCGC 1 cut(s) 283
BstKTI GATC 6 cut(s) 73, 444, 505, 628, 892, 1223
BstMAI GTCTC 4 cut(s) 446, 495, 684, 1256
BstMBI GATC 6 cut(s) 70, 441, 502, 625, 889, 1220
BstMWI GCNNNNNNNGC 2 cut(s) 617, 1031
BstNI CCWGG 2 cut(s) 142, 1027
BstSCI CCNGG 2 cut(s) 140, 1025
BstSFI CTRYAG 1 cut(s) 906
BstV1I GCAGC 2 cut(s) 1021, 1171
BstV2I GAAGAC 1 cut(s) 561
BstX2I RGATCY 4 cut(s) 441, 625, 889, 1220
BstXI CCANNNNNNTGG 1 cut(s) 628
BstYI RGATCY 4 cut(s) 441, 625, 889, 1220
BsuRI GGCC 3 cut(s) 30, 752, 1147
BtrI CACGTC 1 cut(s) 460
BtsCI GGATG 4 cut(s) 244, 469, 1061, 1179
BtsI GCAGTG 1 cut(s) 832
BtsIMutI CAGTG 2 cut(s) 832, 1104
BveI ACCTGC 1 cut(s) 1189
Cac8I GCNNGC 1 cut(s) 754
CaiI CAGNNNCTG 1 cut(s) 995
CfoI GCGC 1 cut(s) 283
Cfr10I RCCGGY 1 cut(s) 19
Cfr13I GGNCC 1 cut(s) 982
Csp6I GTAC 1 cut(s) 767
CspAI ACCGGT 1 cut(s) 19
CspCI CAANNNNNGTGG 2 cut(s) 216, 251
CviAII CATG 2 cut(s) 694, 923
CviQI GTAC 1 cut(s) 767
DdeI CTNAG 2 cut(s) 855, 1107
DpnI GATC 6 cut(s) 72, 443, 504, 627, 891, 1222
DpnII GATC 6 cut(s) 70, 441, 502, 625, 889, 1220
EaeI YGGCCR 1 cut(s) 28
Eco130I CCWWGG 1 cut(s) 621
Eco147I AGGCCT 1 cut(s) 1147
Eco31I GGTCTC 1 cut(s) 1256
Eco32I GATATC 2 cut(s) 406, 786
Eco47I GGWCC 1 cut(s) 982
Eco57I CTGAAG 1 cut(s) 885
Eco88I CYCGRG 1 cut(s) 8
EcoRI GAATTC 2 cut(s) 91, 1085
EcoRII CCWGG 2 cut(s) 140, 1025
EcoRV GATATC 2 cut(s) 406, 786
EcoT14I CCWWGG 1 cut(s) 621
EcoT22I ATGCAT 1 cut(s) 661
ErhI CCWWGG 1 cut(s) 621
FaeI CATG 2 cut(s) 697, 926
FatI CATG 2 cut(s) 693, 922
FbaI TGATCA 1 cut(s) 70
Fnu4HI GCNGC 2 cut(s) 1035, 1185
FokI GGATG 4 cut(s) 251, 476, 1068, 1186
Fsp4HI GCNGC 2 cut(s) 1035, 1185
FspBI CTAG 2 cut(s) 744, 1131
GlaI GCGC 1 cut(s) 282
GluI GCNGC 2 cut(s) 1035, 1185
HaeIII GGCC 3 cut(s) 30, 752, 1147
HapII CCGG 2 cut(s) 20, 445
HhaI GCGC 1 cut(s) 283
Hin1II CATG 2 cut(s) 697, 926
Hin6I GCGC 1 cut(s) 281
HinP1I GCGC 1 cut(s) 281
HindIII AAGCTT 1 cut(s) 1329
HinfI GANTC 3 cut(s) 155, 296, 851
HpaII CCGG 2 cut(s) 20, 445
HphI GGTGA 2 cut(s) 275, 1322
Hpy166II GTNNAC 2 cut(s) 1162, 1290
Hpy188I TCNGA 7 cut(s) 90, 138, 316, 507, 664, 783, 940
Hpy188III TCNNGA 7 cut(s) 10, 213, 494, 554, 687, 880, 1218
Hpy8I GTNNAC 2 cut(s) 1162, 1290
HpyAV CCTTC 9 cut(s) 121, 154, 254, 438, 463, 589, 909, 1015, 1175
HpyCH4III ACNGT 5 cut(s) 367, 778, 973, 986, 1265
HpyCH4IV ACGT 1 cut(s) 459
HpyF10VI GCNNNNNNNGC 2 cut(s) 617, 1031
HpyF3I CTNAG 2 cut(s) 855, 1107
HpySE526I ACGT 1 cut(s) 459
Hsp92II CATG 2 cut(s) 697, 926
HspAI GCGC 1 cut(s) 281
Ksp22I TGATCA 1 cut(s) 70
Kzo9I GATC 6 cut(s) 70, 441, 502, 625, 889, 1220
LmnI GCTCC 2 cut(s) 872, 1241
Lsp1109I GCAGC 2 cut(s) 1021, 1171
LweI GCATC 5 cut(s) 166, 218, 607, 646, 668
MaeI CTAG 2 cut(s) 744, 1131
MaeII ACGT 1 cut(s) 459
MaeIII GTNAC 3 cut(s) 337, 371, 791
MalI GATC 6 cut(s) 72, 443, 504, 627, 891, 1222
MboI GATC 6 cut(s) 70, 441, 502, 625, 889, 1220
MboII GAAGA 7 cut(s) 185, 451, 561, 653, 860, 1034, 1081
MfeI CAATTG 2 cut(s) 675, 1015
MflI RGATCY 4 cut(s) 441, 625, 889, 1220
MlsI TGGCCA 1 cut(s) 30
MluNI TGGCCA 1 cut(s) 30
MnlI CCTC 5 cut(s) 6, 163, 412, 751, 1158
Mox20I TGGCCA 1 cut(s) 30
Mph1103I ATGCAT 1 cut(s) 661
MroXI GAANNNNTTC 1 cut(s) 1085
MscI TGGCCA 1 cut(s) 30
MseI TTAA 4 cut(s) 35, 41, 270, 1281
MslI CAYNNNNRTG 2 cut(s) 542, 825
Msp20I TGGCCA 1 cut(s) 30
MspA1I CMGCKG 1 cut(s) 905
MspI CCGG 2 cut(s) 20, 445
MspR9I CCNGG 2 cut(s) 142, 1027
MunI CAATTG 2 cut(s) 675, 1015
Mva1269I GAATGC 2 cut(s) 350, 1027
MvaI CCWGG 2 cut(s) 142, 1027
MwoI GCNNNNNNNGC 2 cut(s) 617, 1031
NdeII GATC 6 cut(s) 70, 441, 502, 625, 889, 1220
NlaIII CATG 2 cut(s) 697, 926
NlaIV GGNNCC 2 cut(s) 18, 1216
NmuCI GTSAC 1 cut(s) 791
NsiI ATGCAT 1 cut(s) 661
NspV TTCGAA 1 cut(s) 158
OliI CACNNNNGTG 1 cut(s) 825
PaeR7I CTCGAG 1 cut(s) 8
PceI AGGCCT 1 cut(s) 1147
PctI GAATGC 2 cut(s) 350, 1027
PdmI GAANNNNTTC 1 cut(s) 1085
PfeI GAWTC 3 cut(s) 155, 296, 851
PinAI ACCGGT 1 cut(s) 19
PkrI GCNGC 2 cut(s) 1036, 1186
PsiI TTATAA 1 cut(s) 60
Psp6I CCWGG 2 cut(s) 140, 1025
PspGI CCWGG 2 cut(s) 140, 1025
PspN4I GGNNCC 2 cut(s) 18, 1216
PspPI GGNCC 1 cut(s) 982
PstNI CAGNNNCTG 1 cut(s) 995
PsuI RGATCY 4 cut(s) 441, 625, 889, 1220
PvuII CAGCTG 1 cut(s) 905
RsaI GTAC 1 cut(s) 768
RsaNI GTAC 1 cut(s) 767
RseI CAYNNNNRTG 2 cut(s) 542, 825
SaqAI TTAA 4 cut(s) 35, 41, 270, 1281
SatI GCNGC 2 cut(s) 1035, 1185
Sau3AI GATC 6 cut(s) 70, 441, 502, 625, 889, 1220
Sau96I GGNCC 1 cut(s) 982
ScrFI CCNGG 2 cut(s) 142, 1027
SfaNI GCATC 5 cut(s) 166, 218, 607, 646, 668
SfcI CTRYAG 1 cut(s) 906
Sfr274I CTCGAG 1 cut(s) 8
SfuI TTCGAA 1 cut(s) 158
SinI GGWCC 1 cut(s) 982
SlaI CTCGAG 1 cut(s) 8
SmiMI CAYNNNNRTG 2 cut(s) 542, 825
SmlI CTYRAG 1 cut(s) 8
SmoI CTYRAG 1 cut(s) 8
SseBI AGGCCT 1 cut(s) 1147
SspI AATATT 1 cut(s) 320
SspMI CTAG 2 cut(s) 744, 1131
StuI AGGCCT 1 cut(s) 1147
StyD4I CCNGG 2 cut(s) 140, 1025
StyI CCWWGG 1 cut(s) 621
TaaI ACNGT 5 cut(s) 367, 778, 973, 986, 1265
TaiI ACGT 1 cut(s) 462
TaqI TCGA 4 cut(s) 9, 158, 788, 1320
TatI WGTACW 1 cut(s) 766
TfiI GAWTC 3 cut(s) 155, 296, 851
Tru1I TTAA 4 cut(s) 35, 41, 270, 1281
Tru9I TTAA 4 cut(s) 35, 41, 270, 1281
TscAI CASTG 2 cut(s) 832, 1111
TseFI GTSAC 1 cut(s) 791
TseI GCWGC 2 cut(s) 1034, 1184
Tsp45I GTSAC 1 cut(s) 791
TspDTI ATGAA 6 cut(s) 17, 273, 774, 1081, 1098, 1190
TspRI CASTG 2 cut(s) 832, 1111
VpaK11BI GGWCC 1 cut(s) 982
XapI RAATTY 3 cut(s) 91, 724, 1085
XhoI CTCGAG 1 cut(s) 8
XmnI GAANNNNTTC 1 cut(s) 1085
XspI CTAG 2 cut(s) 744, 1131
Zsp2I ATGCAT 1 cut(s) 661
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.