Rorug04G0299900

isoform X1

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
47466350 .. 47467689
1340 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0299900.1

Sequence Viewer

Length: 408 bp
ATGGACAAAGACCTCCCCAGTATCAAGAAATGGGTTGTGCTGTATCCAGTTTACATCAATTCTAAGAAAACTGTGGCTGAAGGGAGGAGAATAGCTCTTGAGAAAGCATGTGAGAATCCGACTTGTGCTGAGATTGGGGATTGCTGCAGCCATTTCAAAGTTCCATTTGCTATTGAGATAGATAAGGCTTATCCACGTGATTTCTTTCAAAGAGGGCGAGTGAGGGTATTGCTCAAAAAGGAAGATGGAACTCCATTTAATCCAGCCATTGCTACTAGGAAACAGCTGATGCTTCGAGTTGCTGAGTTGGTTCCTAGACATCCTGGTAGGACCAAGAAGCAGGAGCCAGCATCAACGTCTACTGCTGGGCCTTCCAAATCTGGGAAGCATGGGAAGAAAAAGAGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

135

Amino Acids

15.2

Weight (kDa)

9.98

Isoelectric Point (pI)

40.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SRP19 PF01922 13 - 107 5.5e-33 SRP19 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 359
AcuI CTGAAG 1 cut(s) 99
AcvI CACGTG 1 cut(s) 197
AfiI CCNNNNNNNGG 1 cut(s) 381
AgsI TTSAA 2 cut(s) 157, 209
AjnI CCWGG 1 cut(s) 322
AluBI AGCT 2 cut(s) 95, 286
AluI AGCT 2 cut(s) 95, 286
AoxI GGCC 1 cut(s) 368
ApeKI GCWGC 2 cut(s) 144, 147
AspS9I GGNCC 2 cut(s) 330, 368
AvaII GGWCC 1 cut(s) 330
BbrPI CACGTG 1 cut(s) 197
BbvI GCAGC 2 cut(s) 131, 159
BccI CCATC 1 cut(s) 239
BciT130I CCWGG 1 cut(s) 324
BciVI GTATCC 1 cut(s) 54
BfaI CTAG 2 cut(s) 276, 315
BfmI CTRYAG 1 cut(s) 145
BfuI GTATCC 1 cut(s) 54
BisI GCNGC 2 cut(s) 145, 148
BlsI GCNGC 2 cut(s) 146, 149
Bme1390I CCNGG 1 cut(s) 324
Bme18I GGWCC 1 cut(s) 330
BmgT120I GGNCC 2 cut(s) 330, 368
BmiI GGNNCC 2 cut(s) 312, 345
BmrFI CCNGG 1 cut(s) 324
BmrI ACTGGG 1 cut(s) 12
BmsI GCATC 2 cut(s) 279, 359
BmuI ACTGGG 1 cut(s) 12
BplI GAGNNNNNCTC 2 cut(s) 79, 111
BpuEI CTTGAG 1 cut(s) 119
BsaAI YACGTR 1 cut(s) 197
Bsc4I CCNNNNNNNGG 1 cut(s) 381
Bse1I ACTGG 2 cut(s) 18, 47
Bse3DI GCAATG 1 cut(s) 267
BseBI CCWGG 1 cut(s) 324
BseGI GGATG 1 cut(s) 319
BseLI CCNNNNNNNGG 1 cut(s) 381
BseMI GCAATG 1 cut(s) 267
BseMII CTCAG 2 cut(s) 120, 294
BseNI ACTGG 2 cut(s) 18, 47
BseRI GAGGAG 1 cut(s) 100
BseXI GCAGC 2 cut(s) 131, 159
BseYI CCCAGC 1 cut(s) 365
BshFI GGCC 1 cut(s) 370
BslI CCNNNNNNNGG 1 cut(s) 381
BsnI GGCC 1 cut(s) 370
BspANI GGCC 1 cut(s) 370
BspCNI CTCAG 2 cut(s) 121, 295
BspLI GGNNCC 2 cut(s) 312, 345
BspMAI CTGCAG 1 cut(s) 149
BsrDI GCAATG 1 cut(s) 267
BsrI ACTGG 2 cut(s) 18, 47
Bst2UI CCWGG 1 cut(s) 324
Bst4CI ACNGT 1 cut(s) 73
BstBAI YACGTR 1 cut(s) 197
BstC8I GCNNGC 1 cut(s) 348
BstDEI CTNAG 3 cut(s) 63, 129, 303
BstF5I GGATG 1 cut(s) 319
BstNI CCWGG 1 cut(s) 324
BstNSI RCATGY 1 cut(s) 111
BstSCI CCNGG 1 cut(s) 322
BstSFI CTRYAG 1 cut(s) 145
BstV1I GCAGC 2 cut(s) 131, 159
BsuI GTATCC 1 cut(s) 54
BsuRI GGCC 1 cut(s) 370
BtsCI GGATG 1 cut(s) 319
Cac8I GCNNGC 1 cut(s) 348
Cfr13I GGNCC 2 cut(s) 330, 368
CviAII CATG 2 cut(s) 108, 389
CviJI RGCY 8 cut(s) 77, 95, 150, 188, 266, 286, 346, 370
CviKI_1 RGCY 8 cut(s) 77, 95, 150, 188, 266, 286, 346, 370
DdeI CTNAG 3 cut(s) 63, 129, 303
Eco47I GGWCC 1 cut(s) 330
Eco57I CTGAAG 1 cut(s) 99
Eco72I CACGTG 1 cut(s) 197
EcoRII CCWGG 1 cut(s) 322
FaeI CATG 2 cut(s) 111, 392
FaiI YATR 2 cut(s) 109, 390
FatI CATG 2 cut(s) 107, 388
FblI GTMKAC 1 cut(s) 359
Fnu4HI GCNGC 2 cut(s) 145, 148
FokI GGATG 1 cut(s) 306
Fsp4HI GCNGC 2 cut(s) 145, 148
FspBI CTAG 2 cut(s) 276, 315
GluI GCNGC 2 cut(s) 145, 148
GsaI CCCAGC 1 cut(s) 369
HaeIII GGCC 1 cut(s) 370
Hin1II CATG 2 cut(s) 111, 392
HinfI GANTC 1 cut(s) 115
Hpy166II GTNNAC 2 cut(s) 52, 360
Hpy188I TCNGA 1 cut(s) 120
Hpy188III TCNNGA 2 cut(s) 25, 98
Hpy8I GTNNAC 2 cut(s) 52, 360
HpyAV CCTTC 2 cut(s) 74, 381
HpyCH4III ACNGT 1 cut(s) 73
HpyCH4IV ACGT 2 cut(s) 196, 356
HpyCH4V TGCA 1 cut(s) 147
HpyF3I CTNAG 3 cut(s) 63, 129, 303
HpySE526I ACGT 2 cut(s) 196, 356
Hsp92II CATG 2 cut(s) 111, 392
LmnI GCTCC 1 cut(s) 343
LpnPI CCDG 9 cut(s) 31, 60, 276, 309, 326, 336, 351, 360, 366
Lsp1109I GCAGC 2 cut(s) 131, 159
LweI GCATC 2 cut(s) 279, 359
MaeI CTAG 2 cut(s) 276, 315
MaeII ACGT 2 cut(s) 196, 356
MboII GAAGA 2 cut(s) 254, 406
MluCI AATT 1 cut(s) 58
MmeI TCCRAC 1 cut(s) 143
MnlI CCTC 4 cut(s) 23, 78, 206, 216
MseI TTAA 1 cut(s) 258
MspA1I CMGCKG 1 cut(s) 286
MspR9I CCNGG 1 cut(s) 324
MvaI CCWGG 1 cut(s) 324
NlaIII CATG 2 cut(s) 111, 392
NlaIV GGNNCC 2 cut(s) 312, 345
NspI RCATGY 1 cut(s) 111
PfeI GAWTC 1 cut(s) 115
PkrI GCNGC 2 cut(s) 146, 149
PmaCI CACGTG 1 cut(s) 197
PmlI CACGTG 1 cut(s) 197
Ppu21I YACGTR 1 cut(s) 197
Psp6I CCWGG 1 cut(s) 322
PspCI CACGTG 1 cut(s) 197
PspFI CCCAGC 1 cut(s) 365
PspGI CCWGG 1 cut(s) 322
PspN4I GGNNCC 2 cut(s) 312, 345
PspPI GGNCC 2 cut(s) 330, 368
PstI CTGCAG 1 cut(s) 149
PvuII CAGCTG 1 cut(s) 286
SaqAI TTAA 1 cut(s) 258
SatI GCNGC 2 cut(s) 145, 148
Sau96I GGNCC 2 cut(s) 330, 368
ScrFI CCNGG 1 cut(s) 324
SetI ASST 5 cut(s) 15, 97, 199, 288, 359
SfaNI GCATC 2 cut(s) 279, 359
SfcI CTRYAG 1 cut(s) 145
SinI GGWCC 1 cut(s) 330
SmlI CTYRAG 1 cut(s) 98
SmoI CTYRAG 1 cut(s) 98
Sse9I AATT 1 cut(s) 58
SspMI CTAG 2 cut(s) 276, 315
StyD4I CCNGG 1 cut(s) 322
TaaI ACNGT 1 cut(s) 73
TaiI ACGT 2 cut(s) 199, 359
TaqI TCGA 1 cut(s) 295
TasI AATT 1 cut(s) 58
TfiI GAWTC 1 cut(s) 115
Tru1I TTAA 1 cut(s) 258
Tru9I TTAA 1 cut(s) 258
TseI GCWGC 2 cut(s) 144, 147
VpaK11BI GGWCC 1 cut(s) 330
XceI RCATGY 1 cut(s) 111
XmiI GTMKAC 1 cut(s) 359
XspI CTAG 2 cut(s) 276, 315
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.