Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006114.1

Orthogroup ID

OG0002225

Physical Location & Seq

Genomic Coordinates Forward (+)

30150 .. 36479

Gene Structure 6330 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006114.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 900 bp

atgatctacacttatcaaggaacatttggtatgaagaagtcaaagaccaattccgaagtctcagtggagattcaattgaaggaagcttcagaagtctatgaagctggaattatcaaggagagccctacaagaattctacaagattatggaagaattctacaagattatgccaagatgagtccatcatattatcctttggataatggacatccctatgcaccttctctcctttggttggtgtccaatgatgtgttggattttgttgcctctgatgctagacttgtctatgtgggcaagactgctgggtaccatagcagaacccaggaggagatacatgaattgctactgagttttgctgaagctggagctactgttgtgagattaaaaggaggggatccactggtgtttggaaggggtggagaggagatggattttttgcaacagcaaggaattcaagtgcaagttattcctggcatcactgctgcttctgggatagcagcagagcttgggatcccattaactcatagaggtgttgcaaatagtgtaagatttctgaccgggcactccaggaagggaggaacagatcctctttttgtgacagagaatgcagctgaccctgattcgaccttggtggtatacatgggtttgtcgactctcccttctcttgctcaaaagttggtccatcatggtctgccaccaacaacaccagctgttgcaattgagcgagggaccacacctcaacagcgcatggtctttgcagaactgaaggatcttgccaatgaaattacatcagcagagttagtatcaccaacactcatcgtcattgggaaagtagttgcactttcgccattgtggccacataatttgaatgaagtgacctctcttgttggagccatatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00860 ko01100 ko01110 ko01120 map00860 map01100 map01110 map01120

Pfam Domains

Protein Families

TP_methylase

Protein Analysis

299

Amino Acids

32.3

Weight (kDa)

5.49

Isoelectric Point (pI)

38.08

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002225)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G40850 AT5G40850 AT5G40850
fragaria_vesca	FvH4_7g00480 FvH4_7g00480 FvH4_7g00480 FvH4_7g00480 FvH4_7g00480
malus_domestica	MD07G1002800.v1.1
prunus_persica	Prupe.2G005900_v2.0.a1 Prupe.2G005900_v2.0.a1 Prupe.2G005900_v2.0.a1 Prupe.2G005900_v2.0.a1 Prupe.I005100_v2.0.a1
pyrus_communis	pycom02g26670 pycom07g00280
rosa_chinensis	RchiOBHm_Chr1g0314251 RchiOBHm_Chr4g0408791 RchiOBHm_Chr6g0277781
rosa_laevigata	RLG00000013272 RLG00000030770
rosa_multiflora	Rmu_sc0002211.1_g000012 Rmu_sc0006114.1_g000007 Rmu_sc0008256.1_g000002 Rmu_sc0013258.1_g000003 Rmu_sc0017573.1_g000002 Rmu_sc0038479.1_g000001
rosa_roxburghii	Rroxscaffold_4G00332000 Rroxscaffold_7G00190980
rosa_rugosa	Rorug01G0000600 Rorug06G0110800 Rorug06G0110900
rosa_samantha	Rh1BG002400 Rh1BG268900 Rh1CG009600 Rh1CG009900 Rh4BG149300 Rh6AG221700 Rh6BG225200 Rh6CG227900 Rh6DG218900
rosa_wichuraiana	Rw1G000410 Rw6G019390

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc65I	GGTACC	1 cut(s)	306
AccB1I	GGYRCC	1 cut(s)	306
AccI	GTMKAC	2 cut(s)	636, 650
AclWI	GGATC	6 cut(s)	389, 402, 505, 518, 578, 777
AcoI	YGGCCR	1 cut(s)	854
AcsI	RAATTY	3 cut(s)	132, 153, 450
AcuI	CTGAAG	3 cut(s)	72, 378, 785
AfaI	GTAC	1 cut(s)	308
AfiI	CCNNNNNNNGG	1 cut(s)	235
AgsI	TTSAA	4 cut(s)	74, 79, 455, 868
AjnI	CCWGG	3 cut(s)	321, 469, 566
AluBI	AGCT	7 cut(s)	86, 104, 362, 368, 505, 611, 710
AluI	AGCT	7 cut(s)	86, 104, 362, 368, 505, 611, 710
Alw26I	GTCTC	1 cut(s)	64
AlwI	GGATC	6 cut(s)	389, 402, 505, 518, 578, 777
AoxI	GGCC	1 cut(s)	854
ApeKI	GCWGC	3 cut(s)	482, 497, 608
ApoI	RAATTY	3 cut(s)	132, 153, 450
Asp718I	GGTACC	1 cut(s)	306
AspLEI	GCGC	1 cut(s)	747
AspS9I	GGNCC	2 cut(s)	679, 729
AsuC2I	CCSGG	1 cut(s)	559
AsuHPI	GGTGA	1 cut(s)	798
AvaII	GGWCC	2 cut(s)	679, 729
BaeGI	GKGCMC	1 cut(s)	564
BalI	TGGCCA	1 cut(s)	856
BamHI	GGATCC	2 cut(s)	394, 510
BanI	GGYRCC	1 cut(s)	306
BanII	GRGCYC	1 cut(s)	125
BbvI	GCAGC	3 cut(s)	469, 509, 620
BccI	CCATC	3 cut(s)	190, 421, 690
BciT130I	CCWGG	3 cut(s)	323, 471, 568
BcnI	CCSGG	1 cut(s)	559
BcoDI	GTCTC	1 cut(s)	64
BfaI	CTAG	1 cut(s)	276
BglI	GCCNNNNNGGC	1 cut(s)	853
BisI	GCNGC	3 cut(s)	483, 498, 609
BlsI	GCNGC	3 cut(s)	484, 499, 610
Bme1390I	CCNGG	4 cut(s)	323, 471, 559, 568
Bme18I	GGWCC	2 cut(s)	679, 729
BmgT120I	GGNCC	2 cut(s)	679, 729
BmiI	GGNNCC	5 cut(s)	308, 396, 512, 730, 892
BmrFI	CCNGG	4 cut(s)	323, 471, 559, 568
BmsI	GCATC	2 cut(s)	262, 483
BpmI	CTGGAG	2 cut(s)	384, 550
BpuMI	CCSGG	1 cut(s)	559
BsaJI	CCNNGG	2 cut(s)	321, 627
BsaXI	ACNNNNNCTCC	4 cut(s)	210, 240, 357, 387
Bsc4I	CCNNNNNNNGG	1 cut(s)	235
Bse1I	ACTGG	1 cut(s)	405
BseBI	CCWGG	3 cut(s)	323, 471, 568
BseDI	CCNNGG	2 cut(s)	321, 627
BseGI	GGATG	1 cut(s)	208
BseLI	CCNNNNNNNGG	1 cut(s)	235
BseMII	CTCAG	2 cut(s)	75, 338
BseNI	ACTGG	1 cut(s)	405
BseRI	GAGGAG	2 cut(s)	341, 437
BseSI	GKGCMC	1 cut(s)	564
BseXI	GCAGC	3 cut(s)	469, 509, 620
BseYI	CCCAGC	1 cut(s)	302
BshFI	GGCC	1 cut(s)	856
BshNI	GGYRCC	1 cut(s)	306
BsiSI	CCGG	1 cut(s)	558
BslFI	GGGAC	1 cut(s)	742
BslI	CCNNNNNNNGG	1 cut(s)	235
BsmAI	GTCTC	1 cut(s)	64
BsmFI	GGGAC	1 cut(s)	742
BsmI	GAATGC	1 cut(s)	610
BsnI	GGCC	1 cut(s)	856
Bsp1286I	GDGCHC	2 cut(s)	125, 564
Bsp143I	GATC	5 cut(s)	3, 394, 510, 583, 769
BspANI	GGCC	1 cut(s)	856
BspCNI	CTCAG	2 cut(s)	74, 339
BspLI	GGNNCC	5 cut(s)	308, 396, 512, 730, 892
BspPI	GGATC	6 cut(s)	389, 402, 505, 518, 578, 777
BspT107I	GGYRCC	1 cut(s)	306
BsrI	ACTGG	1 cut(s)	405
BssECI	CCNNGG	2 cut(s)	321, 627
BssMI	GATC	5 cut(s)	3, 394, 510, 583, 769
BssNAI	GTATAC	1 cut(s)	637
BssT1I	CCWWGG	1 cut(s)	627
Bst1107I	GTATAC	1 cut(s)	637
Bst2UI	CCWGG	3 cut(s)	323, 471, 568
Bst4CI	ACNGT	1 cut(s)	373
BstDEI	CTNAG	2 cut(s)	61, 347
BstF5I	GGATG	1 cut(s)	208
BstHHI	GCGC	1 cut(s)	747
BstKTI	GATC	5 cut(s)	6, 397, 513, 586, 772
BstMAI	GTCTC	1 cut(s)	64
BstMBI	GATC	5 cut(s)	3, 394, 510, 583, 769
BstMWI	GCNNNNNNNGC	2 cut(s)	272, 853
BstNI	CCWGG	3 cut(s)	323, 471, 568
BstSCI	CCNGG	4 cut(s)	321, 469, 557, 566
BstSLI	GKGCMC	1 cut(s)	564
BstV1I	GCAGC	3 cut(s)	469, 509, 620
BstX2I	RGATCY	4 cut(s)	394, 510, 583, 769
BstYI	RGATCY	4 cut(s)	394, 510, 583, 769
BstZ17I	GTATAC	1 cut(s)	637
BsuRI	GGCC	1 cut(s)	856
BtsCI	GGATG	1 cut(s)	208
BtsI	GCAGTG	1 cut(s)	477
BtsIMutI	CAGTG	3 cut(s)	69, 398, 477
CfoI	GCGC	1 cut(s)	747
Cfr13I	GGNCC	2 cut(s)	679, 729
Csp6I	GTAC	1 cut(s)	307
CspCI	CAANNNNNGTGG	2 cut(s)	846, 881
CviAII	CATG	4 cut(s)	335, 640, 686, 748
CviQI	GTAC	1 cut(s)	307
DdeI	CTNAG	2 cut(s)	61, 347
DpnI	GATC	5 cut(s)	5, 396, 512, 585, 771
DpnII	GATC	5 cut(s)	3, 394, 510, 583, 769
EaeI	YGGCCR	1 cut(s)	854
Eco130I	CCWWGG	1 cut(s)	627
Eco24I	GRGCYC	1 cut(s)	125
Eco47I	GGWCC	2 cut(s)	679, 729
Eco57I	CTGAAG	3 cut(s)	72, 378, 785
EcoRI	GAATTC	3 cut(s)	132, 153, 450
EcoRII	CCWGG	3 cut(s)	321, 469, 566
EcoT14I	CCWWGG	1 cut(s)	627
EcoT38I	GRGCYC	1 cut(s)	125
ErhI	CCWWGG	1 cut(s)	627
FaeI	CATG	4 cut(s)	338, 643, 689, 751
FaqI	GGGAC	1 cut(s)	742
FatI	CATG	4 cut(s)	334, 639, 685, 747
FblI	GTMKAC	2 cut(s)	636, 650
Fnu4HI	GCNGC	3 cut(s)	483, 498, 609
FokI	GGATG	1 cut(s)	195
FriOI	GRGCYC	1 cut(s)	125
Fsp4HI	GCNGC	3 cut(s)	483, 498, 609
FspBI	CTAG	1 cut(s)	276
GlaI	GCGC	1 cut(s)	746
GluI	GCNGC	3 cut(s)	483, 498, 609
GsaI	CCCAGC	1 cut(s)	306
GsuI	CTGGAG	2 cut(s)	384, 550
HaeIII	GGCC	1 cut(s)	856
HapII	CCGG	1 cut(s)	558
HhaI	GCGC	1 cut(s)	747
Hin1II	CATG	4 cut(s)	338, 643, 689, 751
Hin6I	GCGC	1 cut(s)	745
HinP1I	GCGC	1 cut(s)	745
HincII	GTYRAC	1 cut(s)	651
HindII	GTYRAC	1 cut(s)	651
HindIII	AAGCTT	1 cut(s)	84
HinfI	GANTC	4 cut(s)	70, 178, 620, 652
HpaII	CCGG	1 cut(s)	558
HphI	GGTGA	1 cut(s)	798
Hpy166II	GTNNAC	2 cut(s)	637, 651
Hpy188I	TCNGA	4 cut(s)	55, 91, 271, 555
Hpy8I	GTNNAC	2 cut(s)	637, 651
HpyAV	CCTTC	6 cut(s)	73, 231, 405, 565, 669, 760
HpyCH4III	ACNGT	1 cut(s)	373
HpyCH4V	TGCA	8 cut(s)	218, 439, 460, 536, 608, 716, 758, 839
HpyF10VI	GCNNNNNNNGC	2 cut(s)	272, 853
HpyF3I	CTNAG	2 cut(s)	61, 347
Hsp92II	CATG	4 cut(s)	338, 643, 689, 751
HspAI	GCGC	1 cut(s)	745
KpnI	GGTACC	1 cut(s)	310
Kzo9I	GATC	5 cut(s)	3, 394, 510, 583, 769
LmnI	GCTCC	2 cut(s)	365, 890
Lsp1109I	GCAGC	3 cut(s)	469, 509, 620
LweI	GCATC	2 cut(s)	262, 483
MaeI	CTAG	1 cut(s)	276
MaeIII	GTNAC	2 cut(s)	595, 874
MalI	GATC	5 cut(s)	5, 396, 512, 585, 771
MboI	GATC	5 cut(s)	3, 394, 510, 583, 769
MboII	GAAGA	2 cut(s)	46, 162
MfeI	CAATTG	2 cut(s)	74, 717
MflI	RGATCY	4 cut(s)	394, 510, 583, 769
MhlI	GDGCHC	2 cut(s)	125, 564
MlsI	TGGCCA	1 cut(s)	856
MluNI	TGGCCA	1 cut(s)	856
MlyI	GAGTC	2 cut(s)	187, 646
MmeI	TCCRAC	2 cut(s)	234, 868
Mox20I	TGGCCA	1 cut(s)	856
MscI	TGGCCA	1 cut(s)	856
MseI	TTAA	2 cut(s)	383, 518
MslI	CAYNNNNRTG	2 cut(s)	213, 528
Msp20I	TGGCCA	1 cut(s)	856
MspA1I	CMGCKG	2 cut(s)	611, 710
MspI	CCGG	1 cut(s)	558
MspR9I	CCNGG	4 cut(s)	323, 471, 559, 568
MunI	CAATTG	2 cut(s)	74, 717
Mva1269I	GAATGC	1 cut(s)	610
MvaI	CCWGG	3 cut(s)	323, 471, 568
MwoI	GCNNNNNNNGC	2 cut(s)	272, 853
NciI	CCSGG	1 cut(s)	559
NdeII	GATC	5 cut(s)	3, 394, 510, 583, 769
NlaIII	CATG	4 cut(s)	338, 643, 689, 751
NlaIV	GGNNCC	5 cut(s)	308, 396, 512, 730, 892
NmuCI	GTSAC	2 cut(s)	595, 874
PctI	GAATGC	1 cut(s)	610
PfeI	GAWTC	2 cut(s)	70, 620
PfoI	TCCNGGA	1 cut(s)	566
PkrI	GCNGC	3 cut(s)	484, 499, 610
PleI	GAGTC	2 cut(s)	186, 646
PpsI	GAGTC	2 cut(s)	186, 646
Psp6I	CCWGG	3 cut(s)	321, 469, 566
PspFI	CCCAGC	1 cut(s)	302
PspGI	CCWGG	3 cut(s)	321, 469, 566
PspN4I	GGNNCC	5 cut(s)	308, 396, 512, 730, 892
PspPI	GGNCC	2 cut(s)	679, 729
PsuI	RGATCY	4 cut(s)	394, 510, 583, 769
PvuII	CAGCTG	2 cut(s)	611, 710
RsaI	GTAC	1 cut(s)	308
RsaNI	GTAC	1 cut(s)	307
RseI	CAYNNNNRTG	2 cut(s)	213, 528
SalI	GTCGAC	1 cut(s)	649
SaqAI	TTAA	2 cut(s)	383, 518
SatI	GCNGC	3 cut(s)	483, 498, 609
Sau3AI	GATC	5 cut(s)	3, 394, 510, 583, 769
Sau96I	GGNCC	2 cut(s)	679, 729
SchI	GAGTC	2 cut(s)	187, 646
ScrFI	CCNGG	4 cut(s)	323, 471, 559, 568
SduI	GDGCHC	2 cut(s)	125, 564
SfaNI	GCATC	2 cut(s)	262, 483
SinI	GGWCC	2 cut(s)	679, 729
SmiMI	CAYNNNNRTG	2 cut(s)	213, 528
SspMI	CTAG	1 cut(s)	276
StyD4I	CCNGG	4 cut(s)	321, 469, 557, 566
StyI	CCWWGG	1 cut(s)	627
TaaI	ACNGT	1 cut(s)	373
TaqI	TCGA	2 cut(s)	623, 650
TfiI	GAWTC	2 cut(s)	70, 620
Tru1I	TTAA	2 cut(s)	383, 518
Tru9I	TTAA	2 cut(s)	383, 518
TscAI	CASTG	3 cut(s)	69, 405, 484
TseFI	GTSAC	2 cut(s)	595, 874
TseI	GCWGC	3 cut(s)	482, 497, 608
Tsp45I	GTSAC	2 cut(s)	595, 874
TspDTI	ATGAA	5 cut(s)	47, 114, 351, 795, 885
TspRI	CASTG	3 cut(s)	69, 405, 484
VpaK11BI	GGWCC	2 cut(s)	679, 729
XapI	RAATTY	3 cut(s)	132, 153, 450
XcmI	CCANNNNNNNNNTGG	1 cut(s)	250
XmiI	GTMKAC	2 cut(s)	636, 650
XspI	CTAG	1 cut(s)	276

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.