Rmu_sc0009349.1_g000011

Plastocyanin-like domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0009349.1
Physical Location & Seq
Forward (+)
38260 .. 38514
255 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0009349.1_g000011.1.cds

Sequence Viewer

Length: 255 bp
atggaagtgaccagagaagattatcaatcctgcaacacaaggtatccgatggccttctacattgctggacttgatgctatccctcttgaaaactggacgactactacatctgtggtagaaatttcgaaccacagcggtatgctaggactctcaaggaactatggccactgccaagcaagacaaaaacttcacgccaaggtcactctacaaattgatcaccacttcactgcaagtccaaccccagtaccagagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.48

Weight (kDa)

6.16

Isoelectric Point (pI)

38.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 135
AcoI YGGCCR 1 cut(s) 163
AcsI RAATTY 1 cut(s) 120
AfaI GTAC 1 cut(s) 246
AgsI TTSAA 1 cut(s) 89
AoxI GGCC 2 cut(s) 51, 163
ApoI RAATTY 1 cut(s) 120
AsuHPI GGTGA 1 cut(s) 209
AsuII TTCGAA 1 cut(s) 125
BaeI ACNNNNGTAYC 1 cut(s) 228
BalI TGGCCA 1 cut(s) 165
BccI CCATC 1 cut(s) 43
BciVI GTATCC 1 cut(s) 54
BclI TGATCA 1 cut(s) 214
BfaI CTAG 1 cut(s) 143
BfuI GTATCC 1 cut(s) 54
BmrI ACTGGG 1 cut(s) 236
BmsI GCATC 1 cut(s) 64
BmuI ACTGGG 1 cut(s) 236
Bpu14I TTCGAA 1 cut(s) 125
BpuEI CTTGAG 1 cut(s) 136
BsaJI CCNNGG 1 cut(s) 195
Bse1I ACTGG 2 cut(s) 98, 242
Bse3DI GCAATG 1 cut(s) 60
BseDI CCNNGG 1 cut(s) 195
BseMI GCAATG 1 cut(s) 60
BseNI ACTGG 2 cut(s) 98, 242
BshFI GGCC 2 cut(s) 53, 165
BsnI GGCC 2 cut(s) 53, 165
Bsp119I TTCGAA 1 cut(s) 125
Bsp143I GATC 1 cut(s) 214
BspACI CCGC 1 cut(s) 135
BspANI GGCC 2 cut(s) 53, 165
BspT104I TTCGAA 1 cut(s) 125
BsrDI GCAATG 1 cut(s) 60
BsrI ACTGG 2 cut(s) 98, 242
BssECI CCNNGG 1 cut(s) 195
BssMI GATC 1 cut(s) 214
BssT1I CCWWGG 1 cut(s) 195
BstBI TTCGAA 1 cut(s) 125
BstKTI GATC 1 cut(s) 217
BstMBI GATC 1 cut(s) 214
BsuI GTATCC 1 cut(s) 54
BsuRI GGCC 2 cut(s) 53, 165
BtsI GCAGTG 2 cut(s) 166, 225
BtsIMutI CAGTG 2 cut(s) 166, 225
Csp6I GTAC 1 cut(s) 245
CviJI RGCY 2 cut(s) 53, 165
CviKI_1 RGCY 2 cut(s) 53, 165
CviQI GTAC 1 cut(s) 245
DpnI GATC 1 cut(s) 216
DpnII GATC 1 cut(s) 214
EaeI YGGCCR 1 cut(s) 163
Eco130I CCWWGG 1 cut(s) 195
EcoT14I CCWWGG 1 cut(s) 195
ErhI CCWWGG 1 cut(s) 195
FaiI YATR 2 cut(s) 140, 162
FbaI TGATCA 1 cut(s) 214
FspBI CTAG 1 cut(s) 143
HaeIII GGCC 2 cut(s) 53, 165
HinfI GANTC 1 cut(s) 147
HphI GGTGA 1 cut(s) 209
Hpy188I TCNGA 1 cut(s) 48
Hpy188III TCNNGA 1 cut(s) 86
HpyAV CCTTC 1 cut(s) 64
HpyCH4V TGCA 2 cut(s) 33, 230
Ksp22I TGATCA 1 cut(s) 214
Kzo9I GATC 1 cut(s) 214
LpnPI CCDG 4 cut(s) 25, 43, 51, 79
LweI GCATC 1 cut(s) 64
MaeI CTAG 1 cut(s) 143
MaeIII GTNAC 2 cut(s) 7, 199
MalI GATC 1 cut(s) 216
MboI GATC 1 cut(s) 214
MboII GAAGA 1 cut(s) 29
MlsI TGGCCA 1 cut(s) 165
MluCI AATT 2 cut(s) 120, 210
MluNI TGGCCA 1 cut(s) 165
MlyI GAGTC 1 cut(s) 141
MnlI CCTC 1 cut(s) 93
Mox20I TGGCCA 1 cut(s) 165
MscI TGGCCA 1 cut(s) 165
Msp20I TGGCCA 1 cut(s) 165
MspA1I CMGCKG 1 cut(s) 135
NdeII GATC 1 cut(s) 214
NmuCI GTSAC 2 cut(s) 7, 199
NspV TTCGAA 1 cut(s) 125
PleI GAGTC 1 cut(s) 141
PpsI GAGTC 1 cut(s) 141
RsaI GTAC 1 cut(s) 246
RsaNI GTAC 1 cut(s) 245
Sau3AI GATC 1 cut(s) 214
SchI GAGTC 1 cut(s) 141
SetI ASST 2 cut(s) 44, 201
SfaNI GCATC 1 cut(s) 64
SfuI TTCGAA 1 cut(s) 125
SmlI CTYRAG 1 cut(s) 151
SmoI CTYRAG 1 cut(s) 151
Sse9I AATT 2 cut(s) 120, 210
SsiI CCGC 1 cut(s) 135
SspMI CTAG 1 cut(s) 143
StyI CCWWGG 1 cut(s) 195
TaqI TCGA 1 cut(s) 125
TasI AATT 2 cut(s) 120, 210
TscAI CASTG 2 cut(s) 173, 232
TseFI GTSAC 2 cut(s) 7, 199
Tsp45I GTSAC 2 cut(s) 7, 199
TspRI CASTG 2 cut(s) 173, 232
XapI RAATTY 1 cut(s) 120
XspI CTAG 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.