Rmu_ssc0000340.1_g000007

Putative RNA methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000340.1
Physical Location & Seq
Forward (+)
73583 .. 75963
2381 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000340.1_g000007.1.cds

Sequence Viewer

Length: 279 bp
atgaaatttgttaggcatctattgattgctttcggtggacttgctggattggaagagagcattgaagaggatcataacttaaaggcaaagaatgtgcgggaggtgtttaatatatatttaaacacatgtccgcatcaggggagtcgaacaatacgaacagaggaagcaattttaatttcacttcaatatttccaagaaccaatcaacagagcactgcagagaagtcagcagtcgcctggagaagaagtcaggaagtgcaaggtagcagcaaagctctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

92

Amino Acids

10.52

Weight (kDa)

8.69

Isoelectric Point (pI)

76.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 97, 131
AclWI GGATC 1 cut(s) 78
AcsI RAATTY 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 137
AflIII ACRYGT 1 cut(s) 125
AgsI TTSAA 2 cut(s) 65, 185
AjnI CCWGG 1 cut(s) 235
AluBI AGCT 1 cut(s) 274
AluI AGCT 1 cut(s) 274
Alw21I GWGCWC 1 cut(s) 214
AlwI GGATC 1 cut(s) 78
ApeKI GCWGC 1 cut(s) 266
ApoI RAATTY 1 cut(s) 5
Bbv12I GWGCWC 1 cut(s) 214
BciT130I CCWGG 1 cut(s) 237
BfaI CTAG 1 cut(s) 277
BfmI CTRYAG 1 cut(s) 215
BisI GCNGC 1 cut(s) 267
BlsI GCNGC 1 cut(s) 268
Bme1390I CCNGG 1 cut(s) 237
BmrFI CCNGG 1 cut(s) 237
BmsI GCATC 2 cut(s) 25, 142
BpmI CTGGAG 1 cut(s) 258
BsaXI ACNNNNNCTCC 2 cut(s) 231, 261
Bsc4I CCNNNNNNNGG 1 cut(s) 137
BseBI CCWGG 1 cut(s) 237
BseLI CCNNNNNNNGG 1 cut(s) 137
BsiHKAI GWGCWC 1 cut(s) 214
BslI CCNNNNNNNGG 1 cut(s) 137
Bsp1286I GDGCHC 1 cut(s) 214
Bsp143I GATC 1 cut(s) 70
BspACI CCGC 2 cut(s) 97, 131
BspMAI CTGCAG 1 cut(s) 219
BspPI GGATC 1 cut(s) 78
BssMI GATC 1 cut(s) 70
Bst2UI CCWGG 1 cut(s) 237
Bst6I CTCTTC 2 cut(s) 48, 60
BstKTI GATC 1 cut(s) 73
BstMBI GATC 1 cut(s) 70
BstNI CCWGG 1 cut(s) 237
BstNSI RCATGY 1 cut(s) 129
BstSCI CCNGG 1 cut(s) 235
BstSFI CTRYAG 1 cut(s) 215
BtsI GCAGTG 1 cut(s) 212
BtsIMutI CAGTG 1 cut(s) 212
CviAII CATG 1 cut(s) 126
CviJI RGCY 1 cut(s) 274
CviKI_1 RGCY 1 cut(s) 274
DpnI GATC 1 cut(s) 72
DpnII GATC 1 cut(s) 70
DraI TTTAAA 1 cut(s) 120
Eam1104I CTCTTC 2 cut(s) 48, 60
EarI CTCTTC 2 cut(s) 48, 60
EcoRII CCWGG 1 cut(s) 235
FaeI CATG 1 cut(s) 129
FaiI YATR 4 cut(s) 75, 113, 115, 127
FatI CATG 1 cut(s) 125
FauI CCCGC 1 cut(s) 90
Fnu4HI GCNGC 1 cut(s) 267
Fsp4HI GCNGC 1 cut(s) 267
FspBI CTAG 1 cut(s) 277
GluI GCNGC 1 cut(s) 267
GsuI CTGGAG 1 cut(s) 258
Hin1II CATG 1 cut(s) 129
HinfI GANTC 1 cut(s) 142
Hpy166II GTNNAC 1 cut(s) 38
Hpy188III TCNNGA 1 cut(s) 250
Hpy8I GTNNAC 1 cut(s) 38
HpyCH4V TGCA 2 cut(s) 217, 258
Hsp92II CATG 1 cut(s) 129
Kzo9I GATC 1 cut(s) 70
LpnPI CCDG 5 cut(s) 30, 122, 222, 235, 249
LweI GCATC 2 cut(s) 25, 142
MaeI CTAG 1 cut(s) 277
MalI GATC 1 cut(s) 72
MboI GATC 1 cut(s) 70
MboII GAAGA 3 cut(s) 65, 77, 254
MhlI GDGCHC 1 cut(s) 214
MluCI AATT 3 cut(s) 5, 168, 174
MlyI GAGTC 1 cut(s) 151
MnlI CCTC 3 cut(s) 61, 94, 154
MseI TTAA 4 cut(s) 80, 108, 119, 173
MspR9I CCNGG 1 cut(s) 237
MvaI CCWGG 1 cut(s) 237
NdeII GATC 1 cut(s) 70
NlaIII CATG 1 cut(s) 129
NspI RCATGY 1 cut(s) 129
PciI ACATGT 1 cut(s) 125
PcsI WCGNNNNNNNCGW 1 cut(s) 151
PkrI GCNGC 1 cut(s) 268
PleI GAGTC 1 cut(s) 150
PpsI GAGTC 1 cut(s) 150
PscI ACATGT 1 cut(s) 125
Psp6I CCWGG 1 cut(s) 235
PspGI CCWGG 1 cut(s) 235
PstI CTGCAG 1 cut(s) 219
SaqAI TTAA 4 cut(s) 80, 108, 119, 173
SatI GCNGC 1 cut(s) 267
Sau3AI GATC 1 cut(s) 70
SchI GAGTC 1 cut(s) 151
ScrFI CCNGG 1 cut(s) 237
SduI GDGCHC 1 cut(s) 214
SetI ASST 3 cut(s) 105, 264, 276
SfaNI GCATC 2 cut(s) 25, 142
SfcI CTRYAG 1 cut(s) 215
Sse9I AATT 3 cut(s) 5, 168, 174
SsiI CCGC 2 cut(s) 97, 131
SspI AATATT 1 cut(s) 188
SspMI CTAG 1 cut(s) 277
StyD4I CCNGG 1 cut(s) 235
TaqI TCGA 1 cut(s) 145
TasI AATT 3 cut(s) 5, 168, 174
Tru1I TTAA 4 cut(s) 80, 108, 119, 173
Tru9I TTAA 4 cut(s) 80, 108, 119, 173
TscAI CASTG 1 cut(s) 219
TseI GCWGC 1 cut(s) 266
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 219
XapI RAATTY 1 cut(s) 5
XceI RCATGY 1 cut(s) 129
XspI CTAG 1 cut(s) 277
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.