Rroxscaffold_6G00415160

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Reverse (-)
37393716 .. 37394463
748 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00415160.1

Sequence Viewer

Length: 159 bp
ATGGCACGTTGTATCATCATCCAAGCCAAGGAAGAAGCAGGGATGTATTGGGGGTACAAAGAGCACTATGCTTCCAATATCACTTCGCCCCGTGAGGAACATCTCATCTCTTTCTCCATCGAGGCTTTCGCAATTGAAGAAAATCCTTCCCTGGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

5.97

Weight (kDa)

4.89

Isoelectric Point (pI)

75.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 56
AfiI CCNNNNNNNGG 1 cut(s) 28
AgsI TTSAA 1 cut(s) 137
AjnI CCWGG 1 cut(s) 150
Alw21I GWGCWC 1 cut(s) 66
Bbv12I GWGCWC 1 cut(s) 66
BccI CCATC 1 cut(s) 125
BciT130I CCWGG 1 cut(s) 152
Bme1390I CCNGG 1 cut(s) 152
BmrFI CCNGG 1 cut(s) 152
BsaJI CCNNGG 2 cut(s) 27, 150
Bsc4I CCNNNNNNNGG 1 cut(s) 28
BseBI CCWGG 1 cut(s) 152
BseDI CCNNGG 2 cut(s) 27, 150
BseGI GGATG 2 cut(s) 18, 48
BseLI CCNNNNNNNGG 1 cut(s) 28
BsiHKAI GWGCWC 1 cut(s) 66
BslI CCNNNNNNNGG 1 cut(s) 28
Bsp1286I GDGCHC 1 cut(s) 66
BssECI CCNNGG 2 cut(s) 27, 150
BssT1I CCWWGG 1 cut(s) 27
Bst2UI CCWGG 1 cut(s) 152
BstF5I GGATG 2 cut(s) 18, 48
BstNI CCWGG 1 cut(s) 152
BstSCI CCNGG 1 cut(s) 150
BtsCI GGATG 2 cut(s) 18, 48
Csp6I GTAC 1 cut(s) 55
CviJI RGCY 2 cut(s) 26, 125
CviKI_1 RGCY 2 cut(s) 26, 125
CviQI GTAC 1 cut(s) 55
Eco130I CCWWGG 1 cut(s) 27
EcoRII CCWGG 1 cut(s) 150
EcoT14I CCWWGG 1 cut(s) 27
ErhI CCWWGG 1 cut(s) 27
FaiI YATR 1 cut(s) 69
FokI GGATG 2 cut(s) 5, 55
HpyAV CCTTC 1 cut(s) 156
HpyCH4IV ACGT 1 cut(s) 7
HpySE526I ACGT 1 cut(s) 7
LpnPI CCDG 2 cut(s) 24, 137
MaeII ACGT 1 cut(s) 7
MboII GAAGA 2 cut(s) 44, 149
MfeI CAATTG 1 cut(s) 132
MhlI GDGCHC 1 cut(s) 66
MluCI AATT 1 cut(s) 132
MnlI CCTC 2 cut(s) 88, 115
MspR9I CCNGG 1 cut(s) 152
MunI CAATTG 1 cut(s) 132
MvaI CCWGG 1 cut(s) 152
Psp6I CCWGG 1 cut(s) 150
PspGI CCWGG 1 cut(s) 150
RsaI GTAC 1 cut(s) 56
RsaNI GTAC 1 cut(s) 55
ScrFI CCNGG 1 cut(s) 152
SduI GDGCHC 1 cut(s) 66
SetI ASST 1 cut(s) 10
SgeI CNNG 7 cut(s) 18, 35, 40, 51, 102, 104, 133
Sse9I AATT 1 cut(s) 132
StyD4I CCNGG 1 cut(s) 150
StyI CCWWGG 1 cut(s) 27
TaiI ACGT 1 cut(s) 10
TaqI TCGA 1 cut(s) 120
TasI AATT 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.