Rroxscaffold_4G00306590

Tobamovirus multiplication protein 1

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
27553332 .. 27554627
1296 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00306590.1

Sequence Viewer

Length: 171 bp
ATGGAGGTCGCGGCGTTCGTGTTGAGCTGGTGGGACAACTTTAATGAGTTGACTCGGTGGCAAGACACCATCTTCTACACTCTCTGCACAGCCAACGCCCCTCGGCTCCTCCGTCGCCCTGGTGGAATTGAAACTCTAGCAATCGCAAAAGCCTTTGGGGAATTTAGGTGA

Protein Analysis

56

Amino Acids

6.51

Weight (kDa)

6.09

Isoelectric Point (pI)

54.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 11
AciI CCGC 1 cut(s) 11
AcsI RAATTY 1 cut(s) 161
AgsI TTSAA 1 cut(s) 131
AjnI CCWGG 1 cut(s) 118
AluBI AGCT 1 cut(s) 27
AluI AGCT 1 cut(s) 27
ApoI RAATTY 1 cut(s) 161
BccI CCATC 1 cut(s) 77
BciT130I CCWGG 1 cut(s) 120
BfaI CTAG 1 cut(s) 137
BisI GCNGC 1 cut(s) 12
BlsI GCNGC 1 cut(s) 13
Bme1390I CCNGG 1 cut(s) 120
BmiI GGNNCC 1 cut(s) 107
BmrFI CCNGG 1 cut(s) 120
BsaJI CCNNGG 2 cut(s) 101, 118
BseBI CCWGG 1 cut(s) 120
BseDI CCNNGG 2 cut(s) 101, 118
BseRI GAGGAG 1 cut(s) 98
BsgI GTGCAG 1 cut(s) 70
Bsh1236I CGCG 1 cut(s) 11
BslFI GGGAC 1 cut(s) 47
BsmFI GGGAC 1 cut(s) 47
BspACI CCGC 1 cut(s) 11
BspFNI CGCG 1 cut(s) 11
BspLI GGNNCC 1 cut(s) 107
BssECI CCNNGG 2 cut(s) 101, 118
Bst2UI CCWGG 1 cut(s) 120
BstFNI CGCG 1 cut(s) 11
BstNI CCWGG 1 cut(s) 120
BstSCI CCNGG 1 cut(s) 118
BstUI CGCG 1 cut(s) 11
CviJI RGCY 4 cut(s) 27, 92, 106, 152
CviKI_1 RGCY 4 cut(s) 27, 92, 106, 152
EcoRII CCWGG 1 cut(s) 118
FaqI GGGAC 1 cut(s) 47
Fnu4HI GCNGC 1 cut(s) 12
Fsp4HI GCNGC 1 cut(s) 12
FspBI CTAG 1 cut(s) 137
GluI GCNGC 1 cut(s) 12
HincII GTYRAC 1 cut(s) 51
HindII GTYRAC 1 cut(s) 51
HinfI GANTC 1 cut(s) 52
Hpy166II GTNNAC 1 cut(s) 51
Hpy8I GTNNAC 1 cut(s) 51
Hpy99I CGWCG 1 cut(s) 117
HpyCH4V TGCA 1 cut(s) 87
LmnI GCTCC 1 cut(s) 111
LpnPI CCDG 3 cut(s) 13, 105, 132
MaeI CTAG 1 cut(s) 137
MboII GAAGA 1 cut(s) 64
MluCI AATT 2 cut(s) 126, 161
MlyI GAGTC 1 cut(s) 46
MnlI CCTC 2 cut(s) 111, 119
MseI TTAA 1 cut(s) 42
MspR9I CCNGG 1 cut(s) 120
MvaI CCWGG 1 cut(s) 120
MvnI CGCG 1 cut(s) 11
NlaIV GGNNCC 1 cut(s) 107
NmeAIII GCCGAG 1 cut(s) 82
PcsI WCGNNNNNNNCGW 2 cut(s) 15, 109
PkrI GCNGC 1 cut(s) 13
PleI GAGTC 1 cut(s) 46
PpsI GAGTC 1 cut(s) 46
Psp6I CCWGG 1 cut(s) 118
PspGI CCWGG 1 cut(s) 118
PspN4I GGNNCC 1 cut(s) 107
SaqAI TTAA 1 cut(s) 42
SatI GCNGC 1 cut(s) 12
SchI GAGTC 1 cut(s) 46
ScrFI CCNGG 1 cut(s) 120
SetI ASST 3 cut(s) 9, 29, 170
SgeI CNNG 9 cut(s) 22, 31, 40, 66, 74, 114, 131, 132, 149
Sse9I AATT 2 cut(s) 126, 161
SsiI CCGC 1 cut(s) 11
SspMI CTAG 1 cut(s) 137
StyD4I CCNGG 1 cut(s) 118
TasI AATT 2 cut(s) 126, 161
TauI GCSGC 1 cut(s) 14
Tru1I TTAA 1 cut(s) 42
Tru9I TTAA 1 cut(s) 42
TspGWI ACGGA 1 cut(s) 101
XapI RAATTY 1 cut(s) 161
XspI CTAG 1 cut(s) 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.