Rh3DG141400

Putative RNA methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Forward (+)
12095085 .. 12095577
493 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG141400.1

Sequence Viewer

Length: 186 bp
ATGGCTTCTCGACCTGGTGATATTGATGAGCGCGAGGTTGTTACCCCTGATGTCATGACCAAGTATTTCATAGGTGTCACACTAAAGGAAAGATCTCCAGATGGTGTTGGGAAATTAGTTGATGTGGGCTTGAGTAAGATATTCTCGTTGTCGAGTTTTGCTAGTCTTTCACGAGTTATTGCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

6.59

Weight (kDa)

6.1

Isoelectric Point (pI)

22.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 33
AjnI CCWGG 1 cut(s) 13
AspLEI GCGC 1 cut(s) 33
AsuHPI GGTGA 1 cut(s) 29
BauI CACGAG 1 cut(s) 171
BccI CCATC 1 cut(s) 95
BciT130I CCWGG 1 cut(s) 15
BfaI CTAG 1 cut(s) 162
BglII AGATCT 1 cut(s) 92
Bme1390I CCNGG 1 cut(s) 15
BmrFI CCNGG 1 cut(s) 15
BpmI CTGGAG 1 cut(s) 81
BpuEI CTTGAG 1 cut(s) 151
BseBI CCWGG 1 cut(s) 15
Bsh1236I CGCG 1 cut(s) 33
Bsp143I GATC 1 cut(s) 92
BspFNI CGCG 1 cut(s) 33
BspHI TCATGA 1 cut(s) 54
BssMI GATC 1 cut(s) 92
BssSI CACGAG 1 cut(s) 171
Bst2BI CACGAG 1 cut(s) 171
Bst2UI CCWGG 1 cut(s) 15
BstFNI CGCG 1 cut(s) 33
BstHHI GCGC 1 cut(s) 33
BstKTI GATC 1 cut(s) 95
BstMBI GATC 1 cut(s) 92
BstNI CCWGG 1 cut(s) 15
BstSCI CCNGG 1 cut(s) 13
BstUI CGCG 1 cut(s) 33
BstX2I RGATCY 1 cut(s) 92
BstYI RGATCY 1 cut(s) 92
CciI TCATGA 1 cut(s) 54
CfoI GCGC 1 cut(s) 33
CsiI ACCWGGT 1 cut(s) 13
CviAII CATG 1 cut(s) 55
CviJI RGCY 2 cut(s) 5, 129
CviKI_1 RGCY 2 cut(s) 5, 129
DpnI GATC 1 cut(s) 94
DpnII GATC 1 cut(s) 92
EcoRII CCWGG 1 cut(s) 13
FaeI CATG 1 cut(s) 58
FaiI YATR 2 cut(s) 56, 71
FatI CATG 1 cut(s) 54
FspBI CTAG 1 cut(s) 162
GlaI GCGC 1 cut(s) 32
GsuI CTGGAG 1 cut(s) 81
HhaI GCGC 1 cut(s) 33
Hin1II CATG 1 cut(s) 58
Hin6I GCGC 1 cut(s) 31
HinP1I GCGC 1 cut(s) 31
HphI GGTGA 1 cut(s) 29
Hpy188III TCNNGA 4 cut(s) 9, 55, 98, 171
Hsp92II CATG 1 cut(s) 58
HspAI GCGC 1 cut(s) 31
Kzo9I GATC 1 cut(s) 92
LpnPI CCDG 3 cut(s) 27, 60, 111
MabI ACCWGGT 1 cut(s) 13
MaeI CTAG 1 cut(s) 162
MaeIII GTNAC 2 cut(s) 40, 76
MalI GATC 1 cut(s) 94
MboI GATC 1 cut(s) 92
MflI RGATCY 1 cut(s) 92
MluCI AATT 1 cut(s) 113
MnlI CCTC 1 cut(s) 28
MspR9I CCNGG 1 cut(s) 15
MvaI CCWGG 1 cut(s) 15
MvnI CGCG 1 cut(s) 33
NdeII GATC 1 cut(s) 92
NlaIII CATG 1 cut(s) 58
NmuCI GTSAC 1 cut(s) 76
PagI TCATGA 1 cut(s) 54
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
PsuI RGATCY 1 cut(s) 92
Sau3AI GATC 1 cut(s) 92
ScrFI CCNGG 1 cut(s) 15
SetI ASST 3 cut(s) 16, 39, 76
SexAI ACCWGGT 1 cut(s) 13
SmlI CTYRAG 1 cut(s) 130
SmoI CTYRAG 1 cut(s) 130
Sse9I AATT 1 cut(s) 113
SspMI CTAG 1 cut(s) 162
StyD4I CCNGG 1 cut(s) 13
TaqI TCGA 2 cut(s) 10, 152
TasI AATT 1 cut(s) 113
TseFI GTSAC 1 cut(s) 76
Tsp45I GTSAC 1 cut(s) 76
TspDTI ATGAA 1 cut(s) 58
XspI CTAG 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.