Rmu_ssc0000419.1_g000010

Probable zinc-ribbon domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000419.1
OG0002425
Physical Location & Seq
Forward (+)
44981 .. 46059
1079 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000419.1_g000010.1.cds

Sequence Viewer

Length: 726 bp
atggctactgagttcactacgaaagttcgactagttagatgtcctaaatgccggctgcttctaccggagctgccggattttcaggtctacaagtgtggtggatgtggtgcgattctcctagcgaaaagtcgtctaaacggtctgagaagcaggagcactggtttaaatggaacagtggcagctcagatgaatgatggattgggtcacgtttctgaacatagggcatccagcagcacaagttgtaatggaactctttctgactcgggagaatgctcttcagaccaaatcgatgagaagaatcaaagtaagttttccagagaatgctctttggaaagaaagagtgagagggatgagaatgagtcttcagaaggcactgaatctagcagctcaagtctaaagggtaaggctcctgcctcgggagaattatctttggaaagaaggaatgagagggatgggtgcaattcttcaggaagcattgaatccagctcaagtctaaaggcttcggctcctgcctcaggagaatgctctttgaaaaggaggagtgagagggatgggaataagtcttcagaaggcattgaatctagcagctcaagtctaaaggcttcggctcctgcctcggaagaattctattcggaaagaaggaatgagaggaatgggagtaggtcttcagaaagcattgaatctagcagctcaagtaaggctactgcctcgaagagttcgtcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
zinc_ribbon_12

Protein Analysis

241

Amino Acids

25.55

Weight (kDa)

7.5

Isoelectric Point (pI)

81.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 87
AcsI RAATTY 1 cut(s) 623
AcuI CTGAAG 5 cut(s) 261, 348, 450, 549, 651
AfiI CCNNNNNNNGG 2 cut(s) 416, 515
AgsI TTSAA 4 cut(s) 479, 532, 578, 680
AhlI ACTAGT 1 cut(s) 31
AjuI GAANNNNNNNTTGG 2 cut(s) 182, 214
AluBI AGCT 6 cut(s) 70, 182, 387, 486, 588, 690
AluI AGCT 6 cut(s) 70, 182, 387, 486, 588, 690
Alw21I GWGCWC 1 cut(s) 158
Ama87I CYCGRG 2 cut(s) 262, 415
ApeKI GCWGC 7 cut(s) 55, 70, 179, 231, 384, 585, 687
ApoI RAATTY 1 cut(s) 623
ArsI GACNNNNNNTTYG 1 cut(s) 704
Asp700I GAANNNNTTC 1 cut(s) 253
AvaI CYCGRG 2 cut(s) 262, 415
AxyI CCTNAGG 1 cut(s) 514
BbsI GAAGAC 3 cut(s) 354, 555, 657
Bbv12I GWGCWC 1 cut(s) 158
BbvI GCAGC 7 cut(s) 42, 57, 191, 243, 396, 597, 699
BccI CCATC 3 cut(s) 188, 446, 545
BcuI ACTAGT 1 cut(s) 31
BfaI CTAG 5 cut(s) 32, 119, 381, 582, 684
BisI GCNGC 7 cut(s) 56, 71, 180, 232, 385, 586, 688
BlsI GCNGC 7 cut(s) 57, 72, 181, 233, 386, 587, 689
BmeT110I CYCGRG 2 cut(s) 262, 415
BmiI GGNNCC 3 cut(s) 408, 507, 609
BmsI GCATC 1 cut(s) 233
BpiI GAAGAC 3 cut(s) 354, 555, 657
BpuEI CTTGAG 4 cut(s) 373, 472, 574, 676
Bsa29I ATCGAT 1 cut(s) 288
BsaJI CCNNGG 2 cut(s) 414, 615
BsaWI WCCGGW 1 cut(s) 64
BsaXI ACNNNNNCTCC 2 cut(s) 145, 175
Bsc4I CCNNNNNNNGG 2 cut(s) 416, 515
Bse118I RCCGGY 1 cut(s) 51
Bse1I ACTGG 1 cut(s) 163
Bse21I CCTNAGG 1 cut(s) 514
BseCI ATCGAT 1 cut(s) 288
BseDI CCNNGG 2 cut(s) 414, 615
BseGI GGATG 5 cut(s) 107, 224, 355, 457, 556
BseLI CCNNNNNNNGG 2 cut(s) 416, 515
BseMII CTCAG 3 cut(s) 134, 197, 528
BseNI ACTGG 1 cut(s) 163
BseRI GAGGAG 1 cut(s) 553
BseXI GCAGC 7 cut(s) 42, 57, 191, 243, 396, 597, 699
BshVI ATCGAT 1 cut(s) 288
BsiHKAI GWGCWC 1 cut(s) 158
BsiHKCI CYCGRG 2 cut(s) 262, 415
BsiSI CCGG 3 cut(s) 52, 65, 74
BslI CCNNNNNNNGG 2 cut(s) 416, 515
BsmI GAATGC 3 cut(s) 275, 326, 527
BsoBI CYCGRG 2 cut(s) 262, 415
Bsp1286I GDGCHC 1 cut(s) 158
BspCNI CTCAG 3 cut(s) 135, 196, 527
BspDI ATCGAT 1 cut(s) 288
BspLI GGNNCC 3 cut(s) 408, 507, 609
BspQI GCTCTTC 1 cut(s) 280
BsrFI RCCGGY 1 cut(s) 51
BsrI ACTGG 1 cut(s) 163
BssAI RCCGGY 1 cut(s) 51
BssECI CCNNGG 2 cut(s) 414, 615
Bst4CI ACNGT 2 cut(s) 140, 175
Bst6I CTCTTC 2 cut(s) 280, 707
BstC8I GCNNGC 1 cut(s) 53
BstDEI CTNAG 4 cut(s) 9, 143, 183, 514
BstENI CCTNNNNNAGG 1 cut(s) 513
BstF5I GGATG 5 cut(s) 107, 224, 355, 457, 556
BstV1I GCAGC 7 cut(s) 42, 57, 191, 243, 396, 597, 699
BstV2I GAAGAC 3 cut(s) 354, 555, 657
Bsu15I ATCGAT 1 cut(s) 288
Bsu36I CCTNAGG 1 cut(s) 514
BsuTUI ATCGAT 1 cut(s) 288
BtsCI GGATG 5 cut(s) 107, 224, 355, 457, 556
BtsIMutI CAGTG 3 cut(s) 156, 180, 372
Cac8I GCNNGC 1 cut(s) 53
Cfr10I RCCGGY 1 cut(s) 51
ClaI ATCGAT 1 cut(s) 288
CspCI CAANNNNNGTGG 2 cut(s) 79, 114
DdeI CTNAG 4 cut(s) 9, 143, 183, 514
DraI TTTAAA 1 cut(s) 165
Eam1104I CTCTTC 2 cut(s) 280, 707
EarI CTCTTC 2 cut(s) 280, 707
Eco57I CTGAAG 5 cut(s) 261, 348, 450, 549, 651
Eco81I CCTNAGG 1 cut(s) 514
Eco88I CYCGRG 2 cut(s) 262, 415
EcoNI CCTNNNNNAGG 1 cut(s) 513
EcoRI GAATTC 1 cut(s) 623
FaiI YATR 1 cut(s) 219
FblI GTMKAC 1 cut(s) 87
Fnu4HI GCNGC 7 cut(s) 56, 71, 180, 232, 385, 586, 688
FokI GGATG 5 cut(s) 114, 211, 362, 464, 563
Fsp4HI GCNGC 7 cut(s) 56, 71, 180, 232, 385, 586, 688
FspBI CTAG 5 cut(s) 32, 119, 381, 582, 684
GluI GCNGC 7 cut(s) 56, 71, 180, 232, 385, 586, 688
HapII CCGG 3 cut(s) 52, 65, 74
HinfI GANTC 8 cut(s) 112, 260, 298, 359, 377, 479, 578, 680
HpaII CCGG 3 cut(s) 52, 65, 74
Hpy166II GTNNAC 2 cut(s) 15, 88
Hpy188III TCNNGA 5 cut(s) 264, 315, 417, 468, 516
Hpy8I GTNNAC 2 cut(s) 15, 88
HpyAV CCTTC 4 cut(s) 362, 432, 563, 633
HpyCH4III ACNGT 2 cut(s) 140, 175
HpyCH4IV ACGT 1 cut(s) 207
HpyCH4V TGCA 1 cut(s) 459
HpyF3I CTNAG 4 cut(s) 9, 143, 183, 514
HpySE526I ACGT 1 cut(s) 207
KroI GCCGGC 1 cut(s) 51
KroNI GCCGGC 1 cut(s) 53
LguI GCTCTTC 1 cut(s) 280
LmnI GCTCC 5 cut(s) 67, 153, 412, 511, 613
Lsp1109I GCAGC 7 cut(s) 42, 57, 191, 243, 396, 597, 699
LweI GCATC 1 cut(s) 233
MaeI CTAG 5 cut(s) 32, 119, 381, 582, 684
MaeII ACGT 1 cut(s) 207
MaeIII GTNAC 1 cut(s) 203
MboII GAAGA 8 cut(s) 267, 307, 354, 456, 555, 632, 657, 724
MhlI GDGCHC 1 cut(s) 158
MluCI AATT 3 cut(s) 422, 460, 623
MlyI GAGTC 2 cut(s) 254, 368
MnlI CCTC 9 cut(s) 339, 424, 441, 523, 531, 540, 625, 642, 718
MroNI GCCGGC 1 cut(s) 51
MroXI GAANNNNTTC 1 cut(s) 253
MseI TTAA 2 cut(s) 164, 724
MspI CCGG 3 cut(s) 52, 65, 74
Mva1269I GAATGC 3 cut(s) 275, 326, 527
NaeI GCCGGC 1 cut(s) 53
NgoMIV GCCGGC 1 cut(s) 51
NlaIV GGNNCC 3 cut(s) 408, 507, 609
NmuCI GTSAC 1 cut(s) 203
PciSI GCTCTTC 1 cut(s) 280
PcsI WCGNNNNNNNCGW 1 cut(s) 716
PctI GAATGC 3 cut(s) 275, 326, 527
PdiI GCCGGC 1 cut(s) 53
PdmI GAANNNNTTC 1 cut(s) 253
PfeI GAWTC 6 cut(s) 112, 298, 377, 479, 578, 680
PkrI GCNGC 7 cut(s) 57, 72, 181, 233, 386, 587, 689
PleI GAGTC 2 cut(s) 254, 367
PpsI GAGTC 2 cut(s) 254, 367
PspN4I GGNNCC 3 cut(s) 408, 507, 609
SapI GCTCTTC 1 cut(s) 280
SaqAI TTAA 2 cut(s) 164, 724
SatI GCNGC 7 cut(s) 56, 71, 180, 232, 385, 586, 688
SchI GAGTC 2 cut(s) 254, 368
SduI GDGCHC 1 cut(s) 158
SetI ASST 9 cut(s) 72, 87, 184, 210, 389, 488, 590, 665, 692
SfaNI GCATC 1 cut(s) 233
SmlI CTYRAG 4 cut(s) 388, 487, 589, 691
SmoI CTYRAG 4 cut(s) 388, 487, 589, 691
SpeI ACTAGT 1 cut(s) 31
Sse9I AATT 3 cut(s) 422, 460, 623
SspMI CTAG 5 cut(s) 32, 119, 381, 582, 684
TaaI ACNGT 2 cut(s) 140, 175
TaiI ACGT 1 cut(s) 210
TaqI TCGA 3 cut(s) 28, 288, 710
TasI AATT 3 cut(s) 422, 460, 623
TfiI GAWTC 6 cut(s) 112, 298, 377, 479, 578, 680
Tru1I TTAA 2 cut(s) 164, 724
Tru9I TTAA 2 cut(s) 164, 724
TscAI CASTG 3 cut(s) 163, 180, 379
TseFI GTSAC 1 cut(s) 203
TseI GCWGC 7 cut(s) 55, 70, 179, 231, 384, 585, 687
Tsp45I GTSAC 1 cut(s) 203
TspDTI ATGAA 1 cut(s) 203
TspRI CASTG 3 cut(s) 163, 180, 379
XagI CCTNNNNNAGG 1 cut(s) 513
XapI RAATTY 1 cut(s) 623
XmiI GTMKAC 1 cut(s) 87
XmnI GAANNNNTTC 1 cut(s) 253
XspI CTAG 5 cut(s) 32, 119, 381, 582, 684
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.