Rh7AG476000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
66500870 .. 66511250
10381 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG476000.1

Sequence Viewer

Length: 207 bp
ATGGGAGCAAAAAAGGAAAGGCAGATGAGTGGGAGTGGGTGTCTTAGGTTCTTGATGGTCATTGCAAACCAATGCCACAAGTCTATGTTCTTCCTTAGCTACCAGCTTAATTTCAGAATCAAACCCATCTCAGCTATCAATCTTCACAAGAATGCTACTTTGGAAATCAAGGGAAATGAGCTGGTTCGAGTTATTGATAAGTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.76

Weight (kDa)

10.03

Isoelectric Point (pI)

26.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjuI GAANNNNNNNTTGG 2 cut(s) 143, 175
AluBI AGCT 4 cut(s) 99, 106, 134, 181
AluI AGCT 4 cut(s) 99, 106, 134, 181
BccI CCATC 2 cut(s) 49, 134
Bpu10I CCTNAGC 1 cut(s) 95
BsaXI ACNNNNNCTCC 2 cut(s) 25, 55
Bse3DI GCAATG 1 cut(s) 60
BseMI GCAATG 1 cut(s) 60
BseMII CTCAG 1 cut(s) 144
BsmI GAATGC 1 cut(s) 157
BspCNI CTCAG 1 cut(s) 143
BsrDI GCAATG 1 cut(s) 60
BstDEI CTNAG 3 cut(s) 44, 95, 130
CviJI RGCY 4 cut(s) 99, 106, 134, 181
CviKI_1 RGCY 4 cut(s) 99, 106, 134, 181
DdeI CTNAG 3 cut(s) 44, 95, 130
FaiI YATR 2 cut(s) 86, 205
HinfI GANTC 1 cut(s) 117
Hpy188I TCNGA 1 cut(s) 116
Hpy188III TCNNGA 1 cut(s) 52
HpyCH4V TGCA 1 cut(s) 65
HpyF3I CTNAG 3 cut(s) 44, 95, 130
LmnI GCTCC 1 cut(s) 5
LpnPI CCDG 2 cut(s) 116, 167
MboII GAAGA 2 cut(s) 82, 134
MluCI AATT 1 cut(s) 109
MseI TTAA 1 cut(s) 108
MslI CAYNNNNRTG 1 cut(s) 150
Mva1269I GAATGC 1 cut(s) 157
PctI GAATGC 1 cut(s) 157
PfeI GAWTC 1 cut(s) 117
RseI CAYNNNNRTG 1 cut(s) 150
SaqAI TTAA 1 cut(s) 108
SetI ASST 5 cut(s) 50, 101, 108, 136, 183
SgeI CNNG 7 cut(s) 64, 91, 115, 160, 181, 194, 200
SmiMI CAYNNNNRTG 1 cut(s) 150
Sse9I AATT 1 cut(s) 109
TaqI TCGA 1 cut(s) 187
TasI AATT 1 cut(s) 109
TfiI GAWTC 1 cut(s) 117
Tru1I TTAA 1 cut(s) 108
Tru9I TTAA 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.