Rmu_ssc0000460.1_g000018

RING-type E3 ubiquitin transferase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000460.1
Physical Location & Seq
Reverse (-)
81904 .. 87921
6018 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000460.1_g000018.1.cds

Sequence Viewer

Length: 4428 bp
atggctaagaactatagattttcaatggaccaaaaggacattgctagggtattgattaccacggtagatggttttattcgggatcagctgatcaataaagaacagagaagccaacacagggaacagtgtgctgaaaggttggcagctgaagatggatcctgtggtaaagaaaccgaggttcgttactctgatcaagcagtgctagcaaatctggattggggtattgaggctcttgaagaagcaatcgacacttcaaatatggaaactaagcttgcaagattagaccatgctgaaaaaatgttgcaagtttgtgccatgctgaattctgatcagaaaactgctggagtccccaatttttacctctcggcttgggcacacctcaacttagcatacctgtggaaattgaggaataacatccaaaactcagttctccatgtcattgagatgtttacagttgatccttttttctcacggatagattttgctcccgcaatctggaaacttttgtttcttccacacatgagctcaattatagggtggtattcggagcagaggcaccggcttgtgatggaagtaattcctgattctcatgatctgtctttcacagctgatcttgatcaatttttcaatgagtctttaatcttttcaatgaggccggatcagatagagaaattgcaaaagctggagcagctttatggtgagtcactggatgagaacacaaggctttatgccaagtacttcaaggattgcatgacatctgattcaacctccagtaagaaagtgattccaatgttgccaattgctgagccaccaatgactccattgcatgaggtcagccgctcgattcctgattttgtcaagtttggtcctatcttgcccaagagtgctggcttttctcccatcctcaagtctaaagatggcacaagagacgtaaacagaatgaatctaagttctgcatcttcacaaaatttggagcctgtcagatgggatcctcaggaatgtatccccgaggagaacgaagatgaatctgattatgagccaaatgatgctaatatggcttctgatcacgagaaggaaactggaggaaaagtacagtcatctgtactcaggagtcgagtacatagcccaacaatcttttctccactaatttctcctaaaaattcaccaaaagtttcatctccaaaaccagacacagctgcttctgtattgcgtttactgtctgtcaaaatcacagattcagcagttgccacctctttgcctgcatctccgggcatgagcaatgattacagcatcagctctgcagactctgatgttgaagtgatagagactaccaaaagttgcgggaaagtctatagccgaacatcaagcttgaataatgagcttgtgaaaatgtcgaaaaatagtccacctaatgaaaatgatgaaggaggccagagctgtgtttcacttccatcttctgacaggatgactactaagtcaagaccacctaaggattttgtttgtcctatcactggccagatatttattgatccagttactcttgaaacaggtcagacatacgaaagaaaagcaatccaagaatggctgaaacgaggaaacacaacctgccccattacacggcaacccatctctacaactactcagctgcctaaaacaaactatgttttgaaaagactgataacctcttggaaagaacagcatcctgaactcgctcaagaatgtgcatactacgaaacaccaagaaactcattccaccgctcctccgtgaaagaagtccattctggtaccacaactccacaaagaacatgtgacttcatgggtcataggaataccgatgattatatcagccaaaggagcaaaaggtttatgcaggcagctgtttctacatcaccaaccagtgtgatatctcaagctgtagttgagactattatcaatggcttaaagcctcatgttgcatgtctgtgtacttcagataaacttcaagagtgtgaaacagcagtgctagaaatagccagattatggaaggactcaaagagtgatcctgcaattcatacattcttatcggagctgacaactgtgaatggattcattgaaatactttcagcttctctgaatagggaagtcctgagaacatctatttacatcctctccgagctaatatttgccgatgaaagtgttggagaaacacttaccagtgtagactccgaccttgattgcctggctgctcttttaaagaatggactagctgagcctgctgttctcatttaccagctgaggccggtgtttgctcagctttcagctcatgatcttataccctcccttgtgcagctaattcagagcaaaaatgaggaatcaaatgatcttcaattactaatggaccccaaagatgctgcattagctattcttgagcaagtcttgatgggaggagatgaaaatagcagatccattaatgctttgagtgttttttctgcgaatggtatacctgctctagttaagtgtttagataggccagaaggaagaaggtccattgtttctattctattatgctgcatgcaagctgaaaaaacttgcaggaacttgatagcaaatagaattgagctgtctcctgttctcgaactatttcacgctggaagtgacggtgtgagaggcatatgtgtagagtttctctcagaactggtacagttgaacaggagaacattatgcaatcagatcttgcagacgattaaagacgaaggagcatttagtacaatgcatacctttcttgtatatcttcaaatggctccaatggagcagcaacctgcaattgctactctccttcttcagcttgatctcctggttgagccttggaagatgagcatttatagggaagaatctatagagggactaattgaggcactccgaaggaaagacttctcaaactctcaaatgatggctttagatgccttgttatctcttactggacgtgtgacttcatccggggattcatacactgaagcctggttactcaagattgctgggtttgatcaaccttacaatggtttgatgaaggcagagtggctaagaaaacaagacaatgatttgatggagacaatggaagaagaagagaaagcagtaagctcttggcagaaaaaagttgcttttgtactttgcaaccatgagaagggatccatttttaaagctttggaagaatgcctcaagagtaaatccattgagatggcaaagtcatgtcttgtcatagctacatggctcacacacatgctttctgtacttcctgatacaggtgtgaaaatcagtgctcgcaaggccttgcttgaagaattcataaatgttctccaatcatcgaataatttggaggagaagattttagcaaccctggctttgaaatcttttgtcagtgaaccagctgcacttgaagcactaggagtgtatgctaaatgcatctacaaaacattgagaaagcttaagaggagcactgtggtggcgagtgacataatgaaagcgctgatgaacttgtcatctgttgacgtaacagagttgtggagctgtgctgaagtggttgaactagattcaagctcaaatggggaggttacatctatacttcatctaaaaggccgtgttttaagcagccattctgatggaactatgaaggtatgggatgctggcaagaaagtattaagactgattcaagaagtccgcgagcacacaaaagctgtcacatgcctctatatttcaccttcaggtgataaattatacagtggttcgttagacaaaactattcgggtgtgggcaatcaaagcagaagaaattcattgccttcaggttcacgatgtgaaagaggtagtatatgagttggttgcaaatgctaaagtggcgtgcttcatttctcaaggcactggagtgaaggtttacgaatggtctggggtccaaaaacatgtaaacttcaacaaatatgtaaagagcctagccatgtcagggaacagcctctattgtggttgctctggttacagcatccaggagatcaacttggggagacatatatcaagcacattctactccggcacaagaaagctgttgggaaaacagatgttctattcccttgagattcatgatggcatcctctatgcgggcggttcatcagttgatgcaacagctgggaagatattttcgcttccaaacaaggcggtattaggatcattctcaactggatttgacatccaacgcattgccaccaacaatgacttgatctttacggcaacaaagtgcgggataattgaggtttggttgaaagagcggttcacaagaattgcttccatcaaaacagctggcggcggtcatgccaagatcacatccttggcggcagatatggacggaggattgctgtttgcaggttcctctgatggcagaatccaggtttgggcactagattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

1475

Amino Acids

164.01

Weight (kDa)

5.76

Isoelectric Point (pI)

47.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 1474
Acc36I ACCTGC 4 cut(s) 1613, 2491, 2806, 4376
Acc65I GGTACC 1 cut(s) 1784
AccB1I GGYRCC 2 cut(s) 555, 1784
AccB7I CCANNNNNTGG 1 cut(s) 2019
AccBSI CCGCTC 3 cut(s) 840, 1758, 4291
AccI GTMKAC 2 cut(s) 2199, 2479
AccII CGCG 1 cut(s) 3696
AcoI YGGCCR 1 cut(s) 1513
AcsI RAATTY 5 cut(s) 322, 967, 1159, 3317, 3804
AcuI CTGAAG 7 cut(s) 168, 1953, 2804, 3012, 3570, 3720, 3800
AdeI CACNNNGTG 1 cut(s) 3829
AfeI AGCGCT 1 cut(s) 3501
AflII CTTAAG 1 cut(s) 3461
AflIII ACRYGT 3 cut(s) 1805, 2962, 3931
AjiI CACGTC 1 cut(s) 2963
AjnI CCWGG 6 cut(s) 2217, 2832, 2996, 3372, 4011, 4407
AjuI GAANNNNNNNTTGG 6 cut(s) 411, 443, 1120, 1152, 4396, 4428
AleI CACNNNNGTG 2 cut(s) 3476, 3896
Alw21I GWGCWC 4 cut(s) 527, 3298, 3473, 3702
Alw26I GTCTC 6 cut(s) 921, 1319, 1916, 2607, 3080, 4024
AlwNI CAGNNNCTG 1 cut(s) 1307
Ama87I CYCGRG 1 cut(s) 1007
Aor51HI AGCGCT 1 cut(s) 3501
AoxI GGCC 7 cut(s) 653, 1429, 1513, 2276, 2507, 3303, 3610
ApoI RAATTY 5 cut(s) 322, 967, 1159, 3317, 3804
AseI ATTAAT 1 cut(s) 2448
Asp700I GAANNNNTTC 6 cut(s) 576, 2084, 2619, 2909, 3804, 4306
Asp718I GGTACC 1 cut(s) 1784
AspLEI GCGC 1 cut(s) 3502
AspS9I GGNCC 5 cut(s) 28, 866, 2377, 2523, 3922
AsuC2I CCSGG 2 cut(s) 1269, 2977
AsuHPI GGTGA 5 cut(s) 710, 1155, 1881, 3723, 3752
AsuNHI GCTAGC 1 cut(s) 202
AvaI CYCGRG 1 cut(s) 1007
AvaII GGWCC 5 cut(s) 28, 866, 2377, 2523, 3922
AxyI CCTNAGG 2 cut(s) 993, 1488
BaeGI GKGCMC 2 cut(s) 376, 4420
BaeI ACNNNNGTAYC 2 cut(s) 3267, 3300
BalI TGGCCA 1 cut(s) 1515
BamHI GGATCC 3 cut(s) 155, 988, 3164
BanI GGYRCC 2 cut(s) 555, 1784
BanII GRGCYC 1 cut(s) 527
BarI GAAGNNNNNNTAC 2 cut(s) 2985, 3017
BauI CACGAG 1 cut(s) 1067
Bbv12I GWGCWC 4 cut(s) 527, 3298, 3473, 3702
BbvCI CCTCAGC 1 cut(s) 2273
BceAI ACGGC 3 cut(s) 1634, 3597, 4266
BciT130I CCWGG 6 cut(s) 2219, 2834, 2998, 3374, 4013, 4409
BciVI GTATCC 1 cut(s) 1013
BclI TGATCA 6 cut(s) 90, 190, 328, 616, 1063, 3022
BcnI CCSGG 2 cut(s) 1269, 2977
BcoDI GTCTC 6 cut(s) 921, 1319, 1916, 2607, 3080, 4024
BfaI CTAG 9 cut(s) 45, 203, 2003, 2243, 2489, 3419, 3563, 3962, 4421
BfmI CTRYAG 5 cut(s) 13, 1299, 1351, 1914, 2874
BfoI RGCGCY 1 cut(s) 3503
BfrI CTTAAG 1 cut(s) 3461
BfuAI ACCTGC 4 cut(s) 1613, 2491, 2806, 4376
BfuI GTATCC 1 cut(s) 1013
BglII AGATCT 1 cut(s) 2709
BlpI GCTNAGC 3 cut(s) 804, 2247, 2289
BmcAI AGTACT 1 cut(s) 737
Bme1390I CCNGG 8 cut(s) 1269, 2219, 2834, 2977, 2998, 3374, 4013, 4409
Bme18I GGWCC 5 cut(s) 28, 866, 2377, 2523, 3922
BmeT110I CYCGRG 1 cut(s) 1007
BmgBI CACGTC 1 cut(s) 2963
BmgT120I GGNCC 5 cut(s) 28, 866, 2377, 2523, 3922
BmrFI CCNGG 8 cut(s) 1269, 2219, 2834, 2977, 2998, 3374, 4013, 4409
BmtI GCTAGC 1 cut(s) 206
BplI GAGNNNNNCTC 2 cut(s) 2651, 2683
BpmI CTGGAG 5 cut(s) 363, 704, 754, 1101, 3915
Bpu10I CCTNAGC 1 cut(s) 2273
Bpu1102I GCTNAGC 3 cut(s) 804, 2247, 2289
BpuEI CTTGAG 8 cut(s) 890, 1698, 1893, 2426, 2990, 3179, 3870, 4118
BpuMI CCSGG 2 cut(s) 1269, 2977
BsaBI GATNNNNATC 1 cut(s) 615
BsaJI CCNNGG 7 cut(s) 60, 174, 1008, 2843, 2976, 3372, 4350
Bse118I RCCGGY 2 cut(s) 558, 2278
Bse21I CCTNAGG 2 cut(s) 993, 1488
Bse3DI GCAATG 5 cut(s) 39, 821, 1285, 3808, 4221
Bse8I GATNNNNATC 1 cut(s) 615
BseBI CCWGG 6 cut(s) 2219, 2834, 2998, 3374, 4013, 4409
BseDI CCNNGG 7 cut(s) 60, 174, 1008, 2843, 2976, 3372, 4350
BseJI GATNNNNATC 1 cut(s) 615
BseMI GCAATG 5 cut(s) 39, 821, 1285, 3808, 4221
BseRI GAGGAG 5 cut(s) 1025, 1750, 2439, 3368, 3481
BseSI GKGCMC 2 cut(s) 376, 4420
BseYI CCCAGC 2 cut(s) 3014, 4151
BsgI GTGCAG 2 cut(s) 2345, 3390
Bsh1236I CGCG 1 cut(s) 3696
BshFI GGCC 7 cut(s) 655, 1431, 1515, 2278, 2509, 3305, 3612
BshNI GGYRCC 2 cut(s) 555, 1784
BsiHKAI GWGCWC 4 cut(s) 527, 3298, 3473, 3702
BsiHKCI CYCGRG 1 cut(s) 1007
BsiSI CCGG 6 cut(s) 559, 656, 1268, 2279, 2976, 4056
BslFI GGGAC 2 cut(s) 332, 2895
BsmAI GTCTC 6 cut(s) 921, 1319, 1916, 2607, 3080, 4024
BsmBI CGTCTC 1 cut(s) 921
BsmFI GGGAC 2 cut(s) 332, 2895
BsmI GAATGC 1 cut(s) 3194
BsnI GGCC 7 cut(s) 655, 1431, 1515, 2278, 2509, 3305, 3612
BsoBI CYCGRG 1 cut(s) 1007
Bsp1286I GDGCHC 6 cut(s) 376, 527, 3298, 3473, 3702, 4420
Bsp1720I GCTNAGC 3 cut(s) 804, 2247, 2289
BspANI GGCC 7 cut(s) 655, 1431, 1515, 2278, 2509, 3305, 3612
BspFNI CGCG 1 cut(s) 3696
BspHI TCATGA 3 cut(s) 589, 2302, 4105
BspMAI CTGCAG 1 cut(s) 1303
BspMI ACCTGC 4 cut(s) 1613, 2491, 2806, 4376
BspOI GCTAGC 1 cut(s) 206
BspT107I GGYRCC 2 cut(s) 555, 1784
BspTI CTTAAG 1 cut(s) 3461
BsrBI CCGCTC 3 cut(s) 840, 1758, 4291
BsrDI GCAATG 5 cut(s) 39, 821, 1285, 3808, 4221
BsrFI RCCGGY 2 cut(s) 558, 2278
BssAI RCCGGY 2 cut(s) 558, 2278
BssECI CCNNGG 7 cut(s) 60, 174, 1008, 2843, 2976, 3372, 4350
BssNAI GTATAC 1 cut(s) 2480
BssSI CACGAG 1 cut(s) 1067
BssT1I CCWWGG 2 cut(s) 2843, 4350
Bst1107I GTATAC 1 cut(s) 2480
Bst2BI CACGAG 1 cut(s) 1067
Bst2UI CCWGG 6 cut(s) 2219, 2834, 2998, 3374, 4013, 4409
Bst6I CTCTTC 1 cut(s) 3096
BstAFI CTTAAG 1 cut(s) 3461
BstDSI CCRYGG 1 cut(s) 60
BstENI CCTNNNNNAGG 1 cut(s) 3276
BstFNI CGCG 1 cut(s) 3696
BstH2I RGCGCY 1 cut(s) 3503
BstHHI GCGC 1 cut(s) 3502
BstMAI GTCTC 6 cut(s) 921, 1319, 1916, 2607, 3080, 4024
BstNI CCWGG 6 cut(s) 2219, 2834, 2998, 3374, 4013, 4409
BstNSI RCATGY 6 cut(s) 1809, 1959, 2554, 3259, 3720, 3935
BstSCI CCNGG 8 cut(s) 1267, 2217, 2832, 2975, 2996, 3372, 4011, 4407
BstSFI CTRYAG 5 cut(s) 13, 1299, 1351, 1914, 2874
BstSLI GKGCMC 2 cut(s) 376, 4420
BstUI CGCG 1 cut(s) 3696
BstX2I RGATCY 5 cut(s) 155, 988, 2441, 2709, 3164
BstXI CCANNNNNNTGG 2 cut(s) 3214, 3635
BstYI RGATCY 5 cut(s) 155, 988, 2441, 2709, 3164
BstZ17I GTATAC 1 cut(s) 2480
Bsu36I CCTNAGG 2 cut(s) 993, 1488
BsuI GTATCC 1 cut(s) 1013
BsuRI GGCC 7 cut(s) 655, 1431, 1515, 2278, 2509, 3305, 3612
BtgI CCRYGG 1 cut(s) 60
BtrI CACGTC 1 cut(s) 2963
BtsI GCAGTG 2 cut(s) 204, 2004
BveI ACCTGC 4 cut(s) 1613, 2491, 2806, 4376
CaiI CAGNNNCTG 1 cut(s) 1307
CciI TCATGA 3 cut(s) 589, 2302, 4105
CfoI GCGC 1 cut(s) 3502
Cfr10I RCCGGY 2 cut(s) 558, 2278
Cfr13I GGNCC 5 cut(s) 28, 866, 2377, 2523, 3922
DraI TTTAAA 2 cut(s) 2232, 3175
DraIII CACNNNGTG 1 cut(s) 3829
DrdI GACNNNNNNGTC 1 cut(s) 1474
DseDI GACNNNNNNGTC 1 cut(s) 1474
EaeI YGGCCR 1 cut(s) 1513
Eam1104I CTCTTC 1 cut(s) 3096
EarI CTCTTC 1 cut(s) 3096
Ecl136II GAGCTC 1 cut(s) 525
Eco130I CCWWGG 2 cut(s) 2843, 4350
Eco147I AGGCCT 1 cut(s) 3305
Eco24I GRGCYC 1 cut(s) 527
Eco32I GATATC 1 cut(s) 1905
Eco47I GGWCC 5 cut(s) 28, 866, 2377, 2523, 3922
Eco47III AGCGCT 1 cut(s) 3501
Eco53kI GAGCTC 1 cut(s) 525
Eco57I CTGAAG 7 cut(s) 168, 1953, 2804, 3012, 3570, 3720, 3800
Eco81I CCTNAGG 2 cut(s) 993, 1488
Eco88I CYCGRG 1 cut(s) 1007
EcoICRI GAGCTC 1 cut(s) 525
EcoNI CCTNNNNNAGG 1 cut(s) 3276
EcoRI GAATTC 2 cut(s) 322, 3317
EcoRII CCWGG 6 cut(s) 2217, 2832, 2996, 3372, 4011, 4407
EcoRV GATATC 1 cut(s) 1905
EcoT14I CCWWGG 2 cut(s) 2843, 4350
EcoT22I ATGCAT 2 cut(s) 2754, 3440
EcoT38I GRGCYC 1 cut(s) 527
ErhI CCWWGG 2 cut(s) 2843, 4350
Esp3I CGTCTC 1 cut(s) 921
FalI AAGNNNNNCTT 2 cut(s) 4291, 4323
FaqI GGGAC 2 cut(s) 332, 2895
FauI CCCGC 4 cut(s) 496, 1334, 4117, 4256
FauNDI CATATG 1 cut(s) 2651
FbaI TGATCA 6 cut(s) 90, 190, 328, 616, 1063, 3022
FblI GTMKAC 2 cut(s) 2199, 2479
FriOI GRGCYC 1 cut(s) 527
FspBI CTAG 9 cut(s) 45, 203, 2003, 2243, 2489, 3419, 3563, 3962, 4421
GlaI GCGC 1 cut(s) 3501
GsaI CCCAGC 2 cut(s) 3018, 4155
GsuI CTGGAG 5 cut(s) 363, 704, 754, 1101, 3915
HaeII RGCGCY 1 cut(s) 3503
HaeIII GGCC 7 cut(s) 655, 1431, 1515, 2278, 2509, 3305, 3612
HapII CCGG 6 cut(s) 559, 656, 1268, 2279, 2976, 4056
HhaI GCGC 1 cut(s) 3502
Hin6I GCGC 1 cut(s) 3500
HinP1I GCGC 1 cut(s) 3500
HincII GTYRAC 1 cut(s) 3523
HindII GTYRAC 1 cut(s) 3523
HindIII AAGCTT 4 cut(s) 269, 1366, 3177, 3458
HpaII CCGG 6 cut(s) 559, 656, 1268, 2279, 2976, 4056
HphI GGTGA 5 cut(s) 710, 1155, 1881, 3723, 3752
HpyCH4IV ACGT 3 cut(s) 930, 2962, 3525
HpySE526I ACGT 3 cut(s) 930, 2962, 3525
HspAI GCGC 1 cut(s) 3500
KpnI GGTACC 1 cut(s) 1788
Ksp22I TGATCA 6 cut(s) 90, 190, 328, 616, 1063, 3022
MaeI CTAG 9 cut(s) 45, 203, 2003, 2243, 2489, 3419, 3563, 3962, 4421
MaeII ACGT 3 cut(s) 930, 2962, 3525
MbiI CCGCTC 3 cut(s) 840, 1758, 4291
MfeI CAATTG 2 cut(s) 798, 2802
MflI RGATCY 5 cut(s) 155, 988, 2441, 2709, 3164
MhlI GDGCHC 6 cut(s) 376, 527, 3298, 3473, 3702, 4420
MlsI TGGCCA 1 cut(s) 1515
MluNI TGGCCA 1 cut(s) 1515
MlyI GAGTC 8 cut(s) 354, 641, 710, 811, 1120, 1298, 2021, 2195
MmeI TCCRAC 3 cut(s) 2158, 2229, 4240
Mox20I TGGCCA 1 cut(s) 1515
Mph1103I ATGCAT 2 cut(s) 2754, 3440
MroXI GAANNNNTTC 6 cut(s) 576, 2084, 2619, 2909, 3804, 4306
MscI TGGCCA 1 cut(s) 1515
MslI CAYNNNNRTG 8 cut(s) 394, 443, 1960, 3212, 3254, 3476, 3633, 3896
Msp20I TGGCCA 1 cut(s) 1515
MspCI CTTAAG 1 cut(s) 3461
MspI CCGG 6 cut(s) 559, 656, 1268, 2279, 2976, 4056
MspR9I CCNGG 8 cut(s) 1269, 2219, 2834, 2977, 2998, 3374, 4013, 4409
MunI CAATTG 2 cut(s) 798, 2802
Mva1269I GAATGC 1 cut(s) 3194
MvaI CCWGG 6 cut(s) 2219, 2834, 2998, 3374, 4013, 4409
MvnI CGCG 1 cut(s) 3696
NciI CCSGG 2 cut(s) 1269, 2977
NdeI CATATG 1 cut(s) 2651
NheI GCTAGC 1 cut(s) 202
NmeAIII GCCGAG 1 cut(s) 344
NmuCI GTSAC 6 cut(s) 702, 1808, 2633, 2965, 3485, 3712
NsiI ATGCAT 2 cut(s) 2754, 3440
NspI RCATGY 6 cut(s) 1809, 1959, 2554, 3259, 3720, 3935
OliI CACNNNNGTG 2 cut(s) 3476, 3896
PaeI GCATGC 1 cut(s) 2554
PagI TCATGA 3 cut(s) 589, 2302, 4105
PceI AGGCCT 1 cut(s) 3305
PciI ACATGT 2 cut(s) 1805, 3931
PctI GAATGC 1 cut(s) 3194
PdmI GAANNNNTTC 6 cut(s) 576, 2084, 2619, 2909, 3804, 4306
PflMI CCANNNNNTGG 1 cut(s) 2019
PfoI TCCNGGA 1 cut(s) 4011
PleI GAGTC 8 cut(s) 353, 640, 709, 811, 1119, 1298, 2021, 2195
PpsI GAGTC 8 cut(s) 353, 640, 709, 811, 1119, 1298, 2021, 2195
PscI ACATGT 2 cut(s) 1805, 3931
PshBI ATTAAT 1 cut(s) 2448
Psp124BI GAGCTC 1 cut(s) 527
Psp6I CCWGG 6 cut(s) 2217, 2832, 2996, 3372, 4011, 4407
PspFI CCCAGC 2 cut(s) 3014, 4151
PspGI CCWGG 6 cut(s) 2217, 2832, 2996, 3372, 4011, 4407
PspPI GGNCC 5 cut(s) 28, 866, 2377, 2523, 3922
PstI CTGCAG 1 cut(s) 1303
PstNI CAGNNNCTG 1 cut(s) 1307
PsuI RGATCY 5 cut(s) 155, 988, 2441, 2709, 3164
RseI CAYNNNNRTG 8 cut(s) 394, 443, 1960, 3212, 3254, 3476, 3633, 3896
SacI GAGCTC 1 cut(s) 527
Sau96I GGNCC 5 cut(s) 28, 866, 2377, 2523, 3922
ScaI AGTACT 1 cut(s) 737
SchI GAGTC 8 cut(s) 354, 641, 710, 811, 1120, 1298, 2021, 2195
ScrFI CCNGG 8 cut(s) 1269, 2219, 2834, 2977, 2998, 3374, 4013, 4409
SduI GDGCHC 6 cut(s) 376, 527, 3298, 3473, 3702, 4420
SfcI CTRYAG 5 cut(s) 13, 1299, 1351, 1914, 2874
SinI GGWCC 5 cut(s) 28, 866, 2377, 2523, 3922
SmiMI CAYNNNNRTG 8 cut(s) 394, 443, 1960, 3212, 3254, 3476, 3633, 3896
SmlI CTYRAG 9 cut(s) 905, 1713, 1908, 2405, 3005, 3194, 3461, 3885, 4097
SmoI CTYRAG 9 cut(s) 905, 1713, 1908, 2405, 3005, 3194, 3461, 3885, 4097
SphI GCATGC 1 cut(s) 2554
SseBI AGGCCT 1 cut(s) 3305
SspI AATATT 1 cut(s) 2160
SspMI CTAG 9 cut(s) 45, 203, 2003, 2243, 2489, 3419, 3563, 3962, 4421
SstI GAGCTC 1 cut(s) 527
StuI AGGCCT 1 cut(s) 3305
StyD4I CCNGG 8 cut(s) 1267, 2217, 2832, 2975, 2996, 3372, 4011, 4407
StyI CCWWGG 2 cut(s) 2843, 4350
TaiI ACGT 3 cut(s) 933, 2965, 3528
TaqI TCGA 6 cut(s) 246, 842, 1114, 1394, 2613, 3341
TatI WGTACW 8 cut(s) 735, 1090, 1102, 1117, 1964, 2744, 3142, 3265
TauI GCSGC 3 cut(s) 840, 4329, 4358
TseFI GTSAC 6 cut(s) 702, 1808, 2633, 2965, 3485, 3712
Tsp45I GTSAC 6 cut(s) 702, 1808, 2633, 2965, 3485, 3712
TspGWI ACGGA 3 cut(s) 487, 1753, 4383
Van91I CCANNNNNTGG 1 cut(s) 2019
Vha464I CTTAAG 1 cut(s) 3461
VpaK11BI GGWCC 5 cut(s) 28, 866, 2377, 2523, 3922
VspI ATTAAT 1 cut(s) 2448
XagI CCTNNNNNAGG 1 cut(s) 3276
XapI RAATTY 5 cut(s) 322, 967, 1159, 3317, 3804
XceI RCATGY 6 cut(s) 1809, 1959, 2554, 3259, 3720, 3935
XmiI GTMKAC 2 cut(s) 2199, 2479
XmnI GAANNNNTTC 6 cut(s) 576, 2084, 2619, 2909, 3804, 4306
XspI CTAG 9 cut(s) 45, 203, 2003, 2243, 2489, 3419, 3563, 3962, 4421
ZrmI AGTACT 1 cut(s) 737
Zsp2I ATGCAT 2 cut(s) 2754, 3440
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.