Rroxscaffold_1G00005150

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
6952278 .. 6964810
12533 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00005150.1

Sequence Viewer

Length: 216 bp
ATGGTAAGGACCCCAAGGATTTGCAGCAAGAGATTATCGACGGCGACAGAATGGAAACCTCTGGATTTAGCTCGACAAGGATTGTTTGGTGGAAGTGAGTCCTTTTTGGATGTTGAAAGTGCTCGATTGAAAGTGTTCTGGAGTCCACTAGAGATAAAAGAGAATAATCTCAATTTGATTGATAATATGATAAAAGATAGTTCTGCAGCAGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.0

Weight (kDa)

7.9

Isoelectric Point (pI)

35.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 116, 130
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
Alw21I GWGCWC 1 cut(s) 124
ApeKI GCWGC 2 cut(s) 24, 206
Asp700I GAANNNNTTC 1 cut(s) 134
AspS9I GGNCC 1 cut(s) 9
AvaII GGWCC 1 cut(s) 9
Bbv12I GWGCWC 1 cut(s) 124
BbvI GCAGC 1 cut(s) 36
BceAI ACGGC 1 cut(s) 57
BfaI CTAG 1 cut(s) 149
BfmI CTRYAG 1 cut(s) 204
BisI GCNGC 2 cut(s) 25, 207
BlsI GCNGC 2 cut(s) 26, 208
Bme18I GGWCC 1 cut(s) 9
BmgT120I GGNCC 1 cut(s) 9
BmiI GGNNCC 1 cut(s) 11
BpmI CTGGAG 1 cut(s) 160
BsaJI CCNNGG 1 cut(s) 14
BseDI CCNNGG 1 cut(s) 14
BseGI GGATG 1 cut(s) 115
BseXI GCAGC 1 cut(s) 36
BsiHKAI GWGCWC 1 cut(s) 124
Bsp1286I GDGCHC 1 cut(s) 124
BspLI GGNNCC 1 cut(s) 11
BspMAI CTGCAG 1 cut(s) 208
BssECI CCNNGG 1 cut(s) 14
BssT1I CCWWGG 1 cut(s) 14
BstF5I GGATG 1 cut(s) 115
BstSFI CTRYAG 1 cut(s) 204
BstV1I GCAGC 1 cut(s) 36
BtsCI GGATG 1 cut(s) 115
Cfr13I GGNCC 1 cut(s) 9
CviJI RGCY 1 cut(s) 71
CviKI_1 RGCY 1 cut(s) 71
Eco130I CCWWGG 1 cut(s) 14
Eco47I GGWCC 1 cut(s) 9
EcoO109I RGGNCCY 1 cut(s) 9
EcoT14I CCWWGG 1 cut(s) 14
ErhI CCWWGG 1 cut(s) 14
FaiI YATR 1 cut(s) 188
Fnu4HI GCNGC 2 cut(s) 25, 207
FokI GGATG 1 cut(s) 122
Fsp4HI GCNGC 2 cut(s) 25, 207
FspBI CTAG 1 cut(s) 149
GluI GCNGC 2 cut(s) 25, 207
GsuI CTGGAG 1 cut(s) 160
HinfI GANTC 2 cut(s) 98, 142
Hpy166II GTNNAC 1 cut(s) 146
Hpy188III TCNNGA 2 cut(s) 62, 139
Hpy8I GTNNAC 1 cut(s) 146
Hpy99I CGWCG 1 cut(s) 43
HpyCH4V TGCA 2 cut(s) 24, 206
LpnPI CCDG 2 cut(s) 47, 124
Lsp1109I GCAGC 1 cut(s) 36
MaeI CTAG 1 cut(s) 149
MhlI GDGCHC 1 cut(s) 124
MluCI AATT 1 cut(s) 172
MlyI GAGTC 2 cut(s) 107, 151
MnlI CCTC 1 cut(s) 69
MroXI GAANNNNTTC 1 cut(s) 134
MseI TTAA 1 cut(s) 214
NlaIV GGNNCC 1 cut(s) 11
PdmI GAANNNNTTC 1 cut(s) 134
PkrI GCNGC 2 cut(s) 26, 208
PleI GAGTC 2 cut(s) 106, 150
PpsI GAGTC 2 cut(s) 106, 150
PpuMI RGGWCCY 1 cut(s) 9
Psp5II RGGWCCY 1 cut(s) 9
PspN4I GGNNCC 1 cut(s) 11
PspPI GGNCC 1 cut(s) 9
PspPPI RGGWCCY 1 cut(s) 9
PstI CTGCAG 1 cut(s) 208
SaqAI TTAA 1 cut(s) 214
SatI GCNGC 2 cut(s) 25, 207
Sau96I GGNCC 1 cut(s) 9
SchI GAGTC 2 cut(s) 107, 151
SduI GDGCHC 1 cut(s) 124
SetI ASST 2 cut(s) 61, 73
SfcI CTRYAG 1 cut(s) 204
SgeI CNNG 8 cut(s) 27, 40, 74, 84, 89, 135, 151, 161
SinI GGWCC 1 cut(s) 9
Sse9I AATT 1 cut(s) 172
SspMI CTAG 1 cut(s) 149
StyI CCWWGG 1 cut(s) 14
TaqI TCGA 3 cut(s) 38, 73, 124
TasI AATT 1 cut(s) 172
Tru1I TTAA 1 cut(s) 214
Tru9I TTAA 1 cut(s) 214
TseI GCWGC 2 cut(s) 24, 206
VpaK11BI GGWCC 1 cut(s) 9
XmnI GAANNNNTTC 1 cut(s) 134
XspI CTAG 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.