Rroxscaffold_3G00239720

tRNA pseudouridine synthase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0005565
Physical Location & Seq
Reverse (-)
30250283 .. 30250525
243 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00239720.1

Sequence Viewer

Length: 243 bp
ATGCTTCCTCCTCACACCCCCATCCTCATCCAAGCTCACCATCTCCTTAGTGTGCTTCTACTTCGCACCGGGAGCTATGACTACCACCGCGTAATCGGTCGAGATCCGGGACCGGATAAGCCGACTGAACTCGCACTTCTCGAAATGGCAACAGAAATTGCAAAGGCTTCTCCGGCGACCGTCAATGGCGACGATGTGGGGGCACTCTACGGAGTCGTTCGAGCTCGCCCGGCCACGCCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

8.58

Weight (kDa)

6.38

Isoelectric Point (pI)

34.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 90
AciI CCGC 1 cut(s) 88
AclWI GGATC 1 cut(s) 98
AcoI YGGCCR 1 cut(s) 231
AdeI CACNNNGTG 1 cut(s) 240
AluBI AGCT 3 cut(s) 35, 75, 224
AluI AGCT 3 cut(s) 35, 75, 224
Alw21I GWGCWC 1 cut(s) 226
AlwI GGATC 1 cut(s) 98
AoxI GGCC 1 cut(s) 231
AspS9I GGNCC 1 cut(s) 110
AsuC2I CCSGG 3 cut(s) 70, 108, 230
AsuHPI GGTGA 1 cut(s) 29
AvaII GGWCC 1 cut(s) 110
BaeGI GKGCMC 1 cut(s) 205
BanII GRGCYC 1 cut(s) 226
Bbv12I GWGCWC 1 cut(s) 226
BccI CCATC 2 cut(s) 29, 48
BceAI ACGGC 1 cut(s) 223
BcnI CCSGG 3 cut(s) 70, 108, 230
Bme1390I CCNGG 3 cut(s) 70, 108, 230
Bme18I GGWCC 1 cut(s) 110
BmgT120I GGNCC 1 cut(s) 110
BmiI GGNNCC 1 cut(s) 111
BmrFI CCNGG 3 cut(s) 70, 108, 230
BpuMI CCSGG 3 cut(s) 70, 108, 230
BsaWI WCCGGW 1 cut(s) 112
BseGI GGATG 2 cut(s) 21, 27
BseSI GKGCMC 1 cut(s) 205
Bsh1236I CGCG 1 cut(s) 90
Bsh1285I CGRYCG 2 cut(s) 100, 180
BshFI GGCC 1 cut(s) 233
BsiEI CGRYCG 2 cut(s) 100, 180
BsiHKAI GWGCWC 1 cut(s) 226
BsiSI CCGG 5 cut(s) 69, 107, 113, 173, 230
BslFI GGGAC 1 cut(s) 123
BsmFI GGGAC 1 cut(s) 123
BsnI GGCC 1 cut(s) 233
Bsp1286I GDGCHC 2 cut(s) 205, 226
Bsp143I GATC 1 cut(s) 103
BspACI CCGC 1 cut(s) 88
BspANI GGCC 1 cut(s) 233
BspFNI CGCG 1 cut(s) 90
BspLI GGNNCC 1 cut(s) 111
BspPI GGATC 1 cut(s) 98
BssMI GATC 1 cut(s) 103
Bst4CI ACNGT 1 cut(s) 181
BstC8I GCNNGC 1 cut(s) 226
BstDEI CTNAG 1 cut(s) 47
BstF5I GGATG 2 cut(s) 21, 27
BstFNI CGCG 1 cut(s) 90
BstKTI GATC 1 cut(s) 106
BstMBI GATC 1 cut(s) 103
BstMCI CGRYCG 2 cut(s) 100, 180
BstMWI GCNNNNNNNGC 3 cut(s) 72, 173, 230
BstSCI CCNGG 3 cut(s) 68, 106, 228
BstSLI GKGCMC 1 cut(s) 205
BstUI CGCG 1 cut(s) 90
BstX2I RGATCY 1 cut(s) 103
BstYI RGATCY 1 cut(s) 103
BsuRI GGCC 1 cut(s) 233
BtsCI GGATG 2 cut(s) 21, 27
Cac8I GCNNGC 1 cut(s) 226
Cfr13I GGNCC 1 cut(s) 110
CviJI RGCY 6 cut(s) 35, 75, 121, 167, 224, 233
CviKI_1 RGCY 6 cut(s) 35, 75, 121, 167, 224, 233
DdeI CTNAG 1 cut(s) 47
DpnI GATC 1 cut(s) 105
DpnII GATC 1 cut(s) 103
DraIII CACNNNGTG 1 cut(s) 240
EaeI YGGCCR 1 cut(s) 231
Ecl136II GAGCTC 1 cut(s) 224
Eco24I GRGCYC 1 cut(s) 226
Eco47I GGWCC 1 cut(s) 110
Eco53kI GAGCTC 1 cut(s) 224
EcoICRI GAGCTC 1 cut(s) 224
EcoT38I GRGCYC 1 cut(s) 226
FaiI YATR 1 cut(s) 78
FaqI GGGAC 1 cut(s) 123
FokI GGATG 2 cut(s) 8, 14
FriOI GRGCYC 1 cut(s) 226
HaeIII GGCC 1 cut(s) 233
HapII CCGG 5 cut(s) 69, 107, 113, 173, 230
HinfI GANTC 1 cut(s) 213
HpaII CCGG 5 cut(s) 69, 107, 113, 173, 230
HphI GGTGA 1 cut(s) 29
Hpy188III TCNNGA 2 cut(s) 101, 140
Hpy99I CGWCG 1 cut(s) 194
HpyCH4III ACNGT 1 cut(s) 181
HpyCH4V TGCA 1 cut(s) 161
HpyF10VI GCNNNNNNNGC 3 cut(s) 72, 173, 230
HpyF3I CTNAG 1 cut(s) 47
Kzo9I GATC 1 cut(s) 103
LmnI GCTCC 1 cut(s) 72
LpnPI CCDG 4 cut(s) 82, 120, 126, 186
MalI GATC 1 cut(s) 105
MboI GATC 1 cut(s) 103
MflI RGATCY 1 cut(s) 103
MhlI GDGCHC 2 cut(s) 205, 226
MluCI AATT 1 cut(s) 156
MlyI GAGTC 1 cut(s) 222
MnlI CCTC 3 cut(s) 18, 21, 35
MspI CCGG 5 cut(s) 69, 107, 113, 173, 230
MspR9I CCNGG 3 cut(s) 70, 108, 230
MvnI CGCG 1 cut(s) 90
MwoI GCNNNNNNNGC 3 cut(s) 72, 173, 230
NciI CCSGG 3 cut(s) 70, 108, 230
NdeII GATC 1 cut(s) 103
NlaIV GGNNCC 1 cut(s) 111
PcsI WCGNNNNNNNCGW 1 cut(s) 138
PfoI TCCNGGA 1 cut(s) 106
PleI GAGTC 1 cut(s) 221
PpsI GAGTC 1 cut(s) 221
Psp124BI GAGCTC 1 cut(s) 226
PspN4I GGNNCC 1 cut(s) 111
PspPI GGNCC 1 cut(s) 110
PsuI RGATCY 1 cut(s) 103
SacI GAGCTC 1 cut(s) 226
Sau3AI GATC 1 cut(s) 103
Sau96I GGNCC 1 cut(s) 110
SchI GAGTC 1 cut(s) 222
ScrFI CCNGG 3 cut(s) 70, 108, 230
SduI GDGCHC 2 cut(s) 205, 226
SetI ASST 3 cut(s) 37, 77, 226
SinI GGWCC 1 cut(s) 110
Sse9I AATT 1 cut(s) 156
SsiI CCGC 1 cut(s) 88
SstI GAGCTC 1 cut(s) 226
StyD4I CCNGG 3 cut(s) 68, 106, 228
TaaI ACNGT 1 cut(s) 181
TaqI TCGA 3 cut(s) 100, 141, 220
TaqII GACCGA 1 cut(s) 86
TasI AATT 1 cut(s) 156
TspGWI ACGGA 1 cut(s) 225
VpaK11BI GGWCC 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.