Rroxscaffold_5G00337340

Belongs to the iron ascorbate-dependent oxidoreductase family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
5410404 .. 5417163
6760 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00337340.1

Sequence Viewer

Length: 243 bp
ATGGAATTCCTGTTGATGTCTTGGATAGGATTAATTACAAATGGAATACGTGAGTTCCATGAGCAGGATAGTGAGCTTAAGAAGAAGTTTTATAAGCGGTTTGGGACGAAGGTGTTTTATCAGTCCAACTACAATTTGTACCAATCTTCATCAGCTGATTGGAGGGATACATTTGGCTGTTTTGTGGCTCCTGATCCACCCAAACCAGAAGAATTGAAGTACCCTCAGTTTGCAGAGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

9.57

Weight (kDa)

6.56

Isoelectric Point (pI)

54.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 93
AciI CCGC 1 cut(s) 97
AclWI GGATC 1 cut(s) 188
AcsI RAATTY 1 cut(s) 5
AfaI GTAC 2 cut(s) 140, 221
AfiI CCNNNNNNNGG 1 cut(s) 64
AflII CTTAAG 1 cut(s) 77
AgsI TTSAA 1 cut(s) 217
AluBI AGCT 2 cut(s) 76, 155
AluI AGCT 2 cut(s) 76, 155
AlwI GGATC 1 cut(s) 188
ApoI RAATTY 1 cut(s) 5
AseI ATTAAT 1 cut(s) 32
BciVI GTATCC 1 cut(s) 160
BfrI CTTAAG 1 cut(s) 77
BfuI GTATCC 1 cut(s) 160
BmiI GGNNCC 1 cut(s) 189
BsaAI YACGTR 1 cut(s) 50
Bsc4I CCNNNNNNNGG 1 cut(s) 64
BseLI CCNNNNNNNGG 1 cut(s) 64
BseMII CTCAG 1 cut(s) 239
BslFI GGGAC 1 cut(s) 118
BslI CCNNNNNNNGG 1 cut(s) 64
BsmFI GGGAC 1 cut(s) 118
Bsp143I GATC 1 cut(s) 193
BspACI CCGC 1 cut(s) 97
BspCNI CTCAG 1 cut(s) 238
BspLI GGNNCC 1 cut(s) 189
BspPI GGATC 1 cut(s) 188
BspTI CTTAAG 1 cut(s) 77
BssMI GATC 1 cut(s) 193
BstAFI CTTAAG 1 cut(s) 77
BstBAI YACGTR 1 cut(s) 50
BstDEI CTNAG 1 cut(s) 225
BstKTI GATC 1 cut(s) 196
BstMBI GATC 1 cut(s) 193
BsuI GTATCC 1 cut(s) 160
Csp6I GTAC 2 cut(s) 139, 220
CviAII CATG 1 cut(s) 59
CviJI RGCY 4 cut(s) 76, 155, 177, 188
CviKI_1 RGCY 4 cut(s) 76, 155, 177, 188
CviQI GTAC 2 cut(s) 139, 220
DdeI CTNAG 1 cut(s) 225
DpnI GATC 1 cut(s) 195
DpnII GATC 1 cut(s) 193
EcoRI GAATTC 1 cut(s) 5
FaeI CATG 1 cut(s) 62
FaiI YATR 2 cut(s) 60, 93
FaqI GGGAC 1 cut(s) 118
FatI CATG 1 cut(s) 58
Hin1II CATG 1 cut(s) 62
Hpy188III TCNNGA 1 cut(s) 191
HpyAV CCTTC 1 cut(s) 103
HpyCH4IV ACGT 1 cut(s) 49
HpyCH4V TGCA 1 cut(s) 233
HpyF3I CTNAG 1 cut(s) 225
HpySE526I ACGT 1 cut(s) 49
Hsp92II CATG 1 cut(s) 62
Kzo9I GATC 1 cut(s) 193
LmnI GCTCC 1 cut(s) 193
LpnPI CCDG 4 cut(s) 23, 50, 204, 219
MaeII ACGT 1 cut(s) 49
MalI GATC 1 cut(s) 195
MboI GATC 1 cut(s) 193
MboII GAAGA 3 cut(s) 94, 138, 221
MluCI AATT 4 cut(s) 5, 33, 133, 212
MmeI TCCRAC 1 cut(s) 150
MnlI CCTC 2 cut(s) 156, 234
MseI TTAA 2 cut(s) 32, 78
MspA1I CMGCKG 1 cut(s) 155
MspCI CTTAAG 1 cut(s) 77
NdeII GATC 1 cut(s) 193
NlaIII CATG 1 cut(s) 62
NlaIV GGNNCC 1 cut(s) 189
Ppu21I YACGTR 1 cut(s) 50
PshBI ATTAAT 1 cut(s) 32
PsiI TTATAA 1 cut(s) 93
PspN4I GGNNCC 1 cut(s) 189
PvuII CAGCTG 1 cut(s) 155
RsaI GTAC 2 cut(s) 140, 221
RsaNI GTAC 2 cut(s) 139, 220
SaqAI TTAA 2 cut(s) 32, 78
Sau3AI GATC 1 cut(s) 193
SetI ASST 4 cut(s) 52, 78, 114, 157
SgeI CNNG 7 cut(s) 22, 33, 62, 71, 77, 203, 218
SmlI CTYRAG 1 cut(s) 77
SmoI CTYRAG 1 cut(s) 77
Sse9I AATT 4 cut(s) 5, 33, 133, 212
SsiI CCGC 1 cut(s) 97
TaiI ACGT 1 cut(s) 52
TasI AATT 4 cut(s) 5, 33, 133, 212
Tru1I TTAA 2 cut(s) 32, 78
Tru9I TTAA 2 cut(s) 32, 78
TspDTI ATGAA 1 cut(s) 138
Vha464I CTTAAG 1 cut(s) 77
VspI ATTAAT 1 cut(s) 32
XapI RAATTY 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.