Rroxscaffold_1G00024600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0005565
Physical Location & Seq
Forward (+)
30568973 .. 30582635
13663 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00024600.1

Sequence Viewer

Length: 171 bp
ATGGTGGACGATCGTGGATCGTTGGGCTGCTTTGAAGACGCAGCGGGATTAGAGCAAATAAGCGGAGTCGCGGAAATTGAAAGCAAAGTGTGCAAAATCATTATAGCAAAGGTGGAGTTTTCAACAAGGATCGATGCAGTCAACTCCCTTGGTCAAAACATCCTTAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

5.97

Weight (kDa)

4.4

Isoelectric Point (pI)

32.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 71
AciI CCGC 3 cut(s) 44, 63, 71
AclWI GGATC 2 cut(s) 25, 137
AgsI TTSAA 3 cut(s) 35, 80, 123
AlwI GGATC 2 cut(s) 25, 137
ApeKI GCWGC 2 cut(s) 27, 41
BbsI GAAGAC 1 cut(s) 42
BbvI GCAGC 2 cut(s) 14, 53
BisI GCNGC 2 cut(s) 28, 42
BlsI GCNGC 2 cut(s) 29, 43
BmsI GCATC 1 cut(s) 124
BpiI GAAGAC 1 cut(s) 42
Bsa29I ATCGAT 1 cut(s) 132
BsaJI CCNNGG 1 cut(s) 148
BseCI ATCGAT 1 cut(s) 132
BseDI CCNNGG 1 cut(s) 148
BseGI GGATG 1 cut(s) 159
BseXI GCAGC 2 cut(s) 14, 53
Bsh1236I CGCG 1 cut(s) 71
Bsh1285I CGRYCG 1 cut(s) 13
BshVI ATCGAT 1 cut(s) 132
BsiEI CGRYCG 1 cut(s) 13
Bsp143I GATC 3 cut(s) 10, 17, 129
BspACI CCGC 3 cut(s) 44, 63, 71
BspDI ATCGAT 1 cut(s) 132
BspFNI CGCG 1 cut(s) 71
BspPI GGATC 2 cut(s) 25, 137
BssECI CCNNGG 1 cut(s) 148
BssMI GATC 3 cut(s) 10, 17, 129
BssT1I CCWWGG 1 cut(s) 148
BstAPI GCANNNNNTGC 1 cut(s) 90
BstF5I GGATG 1 cut(s) 159
BstFNI CGCG 1 cut(s) 71
BstKTI GATC 3 cut(s) 13, 20, 132
BstMBI GATC 3 cut(s) 10, 17, 129
BstMCI CGRYCG 1 cut(s) 13
BstMWI GCNNNNNNNGC 1 cut(s) 90
BstUI CGCG 1 cut(s) 71
BstV1I GCAGC 2 cut(s) 14, 53
BstV2I GAAGAC 1 cut(s) 42
Bsu15I ATCGAT 1 cut(s) 132
BsuTUI ATCGAT 1 cut(s) 132
BtsCI GGATG 1 cut(s) 159
ClaI ATCGAT 1 cut(s) 132
CseI GACGC 1 cut(s) 47
CviJI RGCY 1 cut(s) 27
CviKI_1 RGCY 1 cut(s) 27
DpnI GATC 3 cut(s) 12, 19, 131
DpnII GATC 3 cut(s) 10, 17, 129
Eco130I CCWWGG 1 cut(s) 148
EcoT14I CCWWGG 1 cut(s) 148
ErhI CCWWGG 1 cut(s) 148
FaiI YATR 1 cut(s) 104
FauI CCCGC 1 cut(s) 37
Fnu4HI GCNGC 2 cut(s) 28, 42
FokI GGATG 1 cut(s) 146
Fsp4HI GCNGC 2 cut(s) 28, 42
GluI GCNGC 2 cut(s) 28, 42
HgaI GACGC 1 cut(s) 47
HincII GTYRAC 1 cut(s) 142
HindII GTYRAC 1 cut(s) 142
HinfI GANTC 1 cut(s) 66
Hpy166II GTNNAC 2 cut(s) 7, 142
Hpy8I GTNNAC 2 cut(s) 7, 142
HpyCH4V TGCA 2 cut(s) 93, 137
HpyF10VI GCNNNNNNNGC 1 cut(s) 90
Kzo9I GATC 3 cut(s) 10, 17, 129
Lsp1109I GCAGC 2 cut(s) 14, 53
LweI GCATC 1 cut(s) 124
MalI GATC 3 cut(s) 12, 19, 131
MboI GATC 3 cut(s) 10, 17, 129
MboII GAAGA 1 cut(s) 47
MluCI AATT 2 cut(s) 75, 166
MlyI GAGTC 1 cut(s) 75
MseI TTAA 2 cut(s) 165, 169
MspA1I CMGCKG 1 cut(s) 44
MvnI CGCG 1 cut(s) 71
MwoI GCNNNNNNNGC 1 cut(s) 90
NdeII GATC 3 cut(s) 10, 17, 129
PacI TTAATTAA 1 cut(s) 169
PkrI GCNGC 2 cut(s) 29, 43
Ple19I CGATCG 1 cut(s) 13
PleI GAGTC 1 cut(s) 74
PpsI GAGTC 1 cut(s) 74
PvuI CGATCG 1 cut(s) 13
SaqAI TTAA 2 cut(s) 165, 169
SatI GCNGC 2 cut(s) 28, 42
Sau3AI GATC 3 cut(s) 10, 17, 129
SchI GAGTC 1 cut(s) 75
SetI ASST 1 cut(s) 114
SfaNI GCATC 1 cut(s) 124
SgeI CNNG 5 cut(s) 26, 57, 82, 138, 161
Sse9I AATT 2 cut(s) 75, 166
SsiI CCGC 3 cut(s) 44, 63, 71
StyI CCWWGG 1 cut(s) 148
TaqI TCGA 1 cut(s) 132
TasI AATT 2 cut(s) 75, 166
Tru1I TTAA 2 cut(s) 165, 169
Tru9I TTAA 2 cut(s) 165, 169
TseI GCWGC 2 cut(s) 27, 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.