Rroxscaffold_7G00197170

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
40998361 .. 41009145
10785 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00197170.1

Sequence Viewer

Length: 129 bp
ATGGTGGACGATCGTGGATCGTTGGGCTGCTTTGAAGACGCAGCGGGATTAGAGCGGGAGTTTTTGCAGGTTAGAAGAATCAGAGCAGTGATCGAGTGGATCAGAGTGCTGATGGATGTTGGACGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

42

Amino Acids

4.88

Weight (kDa)

5.14

Isoelectric Point (pI)

31.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 58
AccBSI CCGCTC 1 cut(s) 55
AciI CCGC 2 cut(s) 44, 55
AclWI GGATC 2 cut(s) 25, 107
AgsI TTSAA 1 cut(s) 35
AlwI GGATC 2 cut(s) 25, 107
ApeKI GCWGC 2 cut(s) 27, 41
BbsI GAAGAC 1 cut(s) 42
BbvI GCAGC 2 cut(s) 14, 53
BccI CCATC 1 cut(s) 106
BfuAI ACCTGC 1 cut(s) 58
BisI GCNGC 2 cut(s) 28, 42
BlsI GCNGC 2 cut(s) 29, 43
BpiI GAAGAC 1 cut(s) 42
BseGI GGATG 1 cut(s) 121
BseXI GCAGC 2 cut(s) 14, 53
Bsh1285I CGRYCG 1 cut(s) 13
BsiEI CGRYCG 1 cut(s) 13
Bsp143I GATC 4 cut(s) 10, 17, 90, 99
BspACI CCGC 2 cut(s) 44, 55
BspMI ACCTGC 1 cut(s) 58
BspPI GGATC 2 cut(s) 25, 107
BsrBI CCGCTC 1 cut(s) 55
BssMI GATC 4 cut(s) 10, 17, 90, 99
Bst4CI ACNGT 1 cut(s) 126
BstF5I GGATG 1 cut(s) 121
BstKTI GATC 4 cut(s) 13, 20, 93, 102
BstMBI GATC 4 cut(s) 10, 17, 90, 99
BstMCI CGRYCG 1 cut(s) 13
BstV1I GCAGC 2 cut(s) 14, 53
BstV2I GAAGAC 1 cut(s) 42
BtsCI GGATG 1 cut(s) 121
BtsI GCAGTG 1 cut(s) 93
BtsIMutI CAGTG 1 cut(s) 93
BveI ACCTGC 1 cut(s) 58
CseI GACGC 1 cut(s) 47
CviJI RGCY 1 cut(s) 27
CviKI_1 RGCY 1 cut(s) 27
DpnI GATC 4 cut(s) 12, 19, 92, 101
DpnII GATC 4 cut(s) 10, 17, 90, 99
FauI CCCGC 2 cut(s) 37, 48
Fnu4HI GCNGC 2 cut(s) 28, 42
Fsp4HI GCNGC 2 cut(s) 28, 42
GluI GCNGC 2 cut(s) 28, 42
HgaI GACGC 1 cut(s) 47
HinfI GANTC 1 cut(s) 78
Hpy166II GTNNAC 1 cut(s) 7
Hpy188I TCNGA 2 cut(s) 83, 104
Hpy8I GTNNAC 1 cut(s) 7
HpyCH4III ACNGT 1 cut(s) 126
HpyCH4V TGCA 1 cut(s) 67
Kzo9I GATC 4 cut(s) 10, 17, 90, 99
LpnPI CCDG 1 cut(s) 53
Lsp1109I GCAGC 2 cut(s) 14, 53
MalI GATC 4 cut(s) 12, 19, 92, 101
MbiI CCGCTC 1 cut(s) 55
MboI GATC 4 cut(s) 10, 17, 90, 99
MboII GAAGA 2 cut(s) 47, 87
MmeI TCCRAC 1 cut(s) 100
MspA1I CMGCKG 1 cut(s) 44
NdeII GATC 4 cut(s) 10, 17, 90, 99
PfeI GAWTC 1 cut(s) 78
PkrI GCNGC 2 cut(s) 29, 43
Ple19I CGATCG 1 cut(s) 13
PvuI CGATCG 1 cut(s) 13
SatI GCNGC 2 cut(s) 28, 42
Sau3AI GATC 4 cut(s) 10, 17, 90, 99
SetI ASST 1 cut(s) 72
SgeI CNNG 5 cut(s) 26, 57, 68, 80, 106
SsiI CCGC 2 cut(s) 44, 55
TaaI ACNGT 1 cut(s) 126
TaqI TCGA 1 cut(s) 93
TfiI GAWTC 1 cut(s) 78
TscAI CASTG 1 cut(s) 93
TseI GCWGC 2 cut(s) 27, 41
TspRI CASTG 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.