Rroxscaffold_1G00067170

late embryogenesis abundant protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
88542985 .. 88543376
392 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00067170.1

Sequence Viewer

Length: 312 bp
ATGCAAACCCTAGAAAGCGGTGAGGAAGAAGAAGATAAACCACAGTACAAACACAGAGAACAGATAGAAAAAAACAGAGTGCAGTTACCAAGAACAATGGCGAGCCTTTCATTAGCGAAGAATCTCATCTTCAACCTCTCAAAGTCGTTTCCTCAATCCCAAGTTTCACTTTCTCTCAGACCCTCTCTCAAAATCTCCAGGGTCTGCTTCACCTCCGCCTCCAAATTCTCCGAGGGTCGAAATGCGGCGGAGGAGAATAGGGATTCAAATTCTCACCGGGCGTATGCCGATAAGGACTGGAGGGACAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

103

Amino Acids

11.9

Weight (kDa)

9.16

Isoelectric Point (pI)

52.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 18, 216, 245, 248
AcsI RAATTY 2 cut(s) 224, 268
AfaI GTAC 1 cut(s) 47
AgsI TTSAA 2 cut(s) 133, 267
AjnI CCWGG 1 cut(s) 197
AlwNI CAGNNNCTG 1 cut(s) 204
ApoI RAATTY 2 cut(s) 224, 268
AsuC2I CCSGG 1 cut(s) 278
AsuHPI GGTGA 3 cut(s) 32, 202, 266
BciT130I CCWGG 1 cut(s) 199
BcnI CCSGG 1 cut(s) 278
BfaI CTAG 1 cut(s) 11
BisI GCNGC 1 cut(s) 246
BlsI GCNGC 1 cut(s) 247
Bme1390I CCNGG 2 cut(s) 199, 278
BmrFI CCNGG 2 cut(s) 199, 278
BpmI CTGGAG 1 cut(s) 181
BpuMI CCSGG 1 cut(s) 278
BsaJI CCNNGG 2 cut(s) 198, 231
Bse1I ACTGG 1 cut(s) 302
BseBI CCWGG 1 cut(s) 199
BseDI CCNNGG 2 cut(s) 198, 231
BseMII CTCAG 1 cut(s) 190
BseNI ACTGG 1 cut(s) 302
BseRI GAGGAG 1 cut(s) 266
BsgI GTGCAG 1 cut(s) 101
BsiSI CCGG 1 cut(s) 277
BspACI CCGC 4 cut(s) 18, 216, 245, 248
BspCNI CTCAG 1 cut(s) 189
BsrI ACTGG 1 cut(s) 302
BssECI CCNNGG 2 cut(s) 198, 231
Bst2UI CCWGG 1 cut(s) 199
Bst4CI ACNGT 1 cut(s) 45
BstC8I GCNNGC 1 cut(s) 103
BstDEI CTNAG 1 cut(s) 176
BstNI CCWGG 1 cut(s) 199
BstSCI CCNGG 2 cut(s) 197, 276
Cac8I GCNNGC 1 cut(s) 103
CaiI CAGNNNCTG 1 cut(s) 204
Csp6I GTAC 1 cut(s) 46
CviJI RGCY 1 cut(s) 105
CviKI_1 RGCY 1 cut(s) 105
CviQI GTAC 1 cut(s) 46
DdeI CTNAG 1 cut(s) 176
EciI GGCGGA 2 cut(s) 205, 263
EcoRII CCWGG 1 cut(s) 197
FaiI YATR 1 cut(s) 285
FalI AAGNNNNNCTT 2 cut(s) 153, 185
Fnu4HI GCNGC 1 cut(s) 246
Fsp4HI GCNGC 1 cut(s) 246
FspBI CTAG 1 cut(s) 11
GluI GCNGC 1 cut(s) 246
GsuI CTGGAG 1 cut(s) 181
HapII CCGG 1 cut(s) 277
HinfI GANTC 2 cut(s) 121, 263
HpaII CCGG 1 cut(s) 277
HphI GGTGA 3 cut(s) 32, 202, 266
Hpy188I TCNGA 2 cut(s) 179, 232
HpyCH4III ACNGT 1 cut(s) 45
HpyCH4V TGCA 2 cut(s) 4, 82
HpyF3I CTNAG 1 cut(s) 176
LpnPI CCDG 4 cut(s) 184, 211, 283, 290
MaeI CTAG 1 cut(s) 11
MaeIII GTNAC 1 cut(s) 84
MboII GAAGA 5 cut(s) 38, 41, 44, 121, 130
MluCI AATT 2 cut(s) 224, 268
MnlI CCTC 9 cut(s) 16, 146, 162, 193, 223, 226, 229, 244, 294
MspI CCGG 1 cut(s) 277
MspR9I CCNGG 2 cut(s) 199, 278
MvaI CCWGG 1 cut(s) 199
NciI CCSGG 1 cut(s) 278
PfeI GAWTC 2 cut(s) 121, 263
PkrI GCNGC 1 cut(s) 247
Psp6I CCWGG 1 cut(s) 197
PspGI CCWGG 1 cut(s) 197
PstNI CAGNNNCTG 1 cut(s) 204
RsaI GTAC 1 cut(s) 47
RsaNI GTAC 1 cut(s) 46
SatI GCNGC 1 cut(s) 246
ScrFI CCNGG 2 cut(s) 199, 278
SetI ASST 2 cut(s) 138, 215
SgeI CNNG 9 cut(s) 23, 102, 114, 173, 210, 211, 244, 289, 290
Sse9I AATT 2 cut(s) 224, 268
SsiI CCGC 4 cut(s) 18, 216, 245, 248
SspMI CTAG 1 cut(s) 11
StyD4I CCNGG 2 cut(s) 197, 276
TaaI ACNGT 1 cut(s) 45
TaqI TCGA 1 cut(s) 238
TasI AATT 2 cut(s) 224, 268
TatI WGTACW 1 cut(s) 45
TauI GCSGC 1 cut(s) 248
TfiI GAWTC 2 cut(s) 121, 263
TspDTI ATGAA 1 cut(s) 99
XapI RAATTY 2 cut(s) 224, 268
XspI CTAG 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.