Rroxscaffold_1G00071150

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
92052275 .. 92054225
1951 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00071150.1

Sequence Viewer

Length: 153 bp
ATGGTGAAGCCTAACATGGTGGAGGAGACTAATAGTAGTAGTAACAGTACTGACTCTGGTGATCTTGATGGTGATGAGGAAAGCAAGGGATCGGTGAGAAGATTTGTGAGCTTTCTTGGAGAGAGGATATGGGGTGGTGTCTGGAGCCAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.51

Weight (kDa)

4.4

Isoelectric Point (pI)

45.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 97
AfaI GTAC 1 cut(s) 49
AluBI AGCT 1 cut(s) 111
AluI AGCT 1 cut(s) 111
Alw26I GTCTC 1 cut(s) 20
AlwI GGATC 1 cut(s) 97
AsuHPI GGTGA 4 cut(s) 16, 71, 83, 106
BccI CCATC 1 cut(s) 62
BcoDI GTCTC 1 cut(s) 20
BmcAI AGTACT 1 cut(s) 49
BmiI GGNNCC 1 cut(s) 146
Bse1I ACTGG 1 cut(s) 148
BseNI ACTGG 1 cut(s) 148
BseRI GAGGAG 1 cut(s) 38
BsmAI GTCTC 1 cut(s) 20
Bsp143I GATC 2 cut(s) 61, 89
BspLI GGNNCC 1 cut(s) 146
BspPI GGATC 1 cut(s) 97
BsrI ACTGG 1 cut(s) 148
BssMI GATC 2 cut(s) 61, 89
Bst4CI ACNGT 1 cut(s) 47
BstKTI GATC 2 cut(s) 64, 92
BstMAI GTCTC 1 cut(s) 20
BstMBI GATC 2 cut(s) 61, 89
Csp6I GTAC 1 cut(s) 48
CviAII CATG 1 cut(s) 16
CviJI RGCY 3 cut(s) 10, 111, 147
CviKI_1 RGCY 3 cut(s) 10, 111, 147
CviQI GTAC 1 cut(s) 48
DpnI GATC 2 cut(s) 63, 91
DpnII GATC 2 cut(s) 61, 89
FaeI CATG 1 cut(s) 19
FaiI YATR 2 cut(s) 17, 130
FatI CATG 1 cut(s) 15
Hin1II CATG 1 cut(s) 19
HinfI GANTC 1 cut(s) 53
HphI GGTGA 4 cut(s) 16, 71, 83, 106
Hpy188III TCNNGA 2 cut(s) 65, 142
HpyCH4III ACNGT 1 cut(s) 47
Hsp92II CATG 1 cut(s) 19
Kzo9I GATC 2 cut(s) 61, 89
LmnI GCTCC 1 cut(s) 144
LpnPI CCDG 2 cut(s) 42, 127
MaeIII GTNAC 1 cut(s) 41
MalI GATC 2 cut(s) 63, 91
MboI GATC 2 cut(s) 61, 89
MboII GAAGA 1 cut(s) 111
MlyI GAGTC 1 cut(s) 47
MnlI CCTC 3 cut(s) 16, 70, 117
NdeII GATC 2 cut(s) 61, 89
NlaIII CATG 1 cut(s) 19
NlaIV GGNNCC 1 cut(s) 146
PleI GAGTC 1 cut(s) 47
PpsI GAGTC 1 cut(s) 47
PspN4I GGNNCC 1 cut(s) 146
RsaI GTAC 1 cut(s) 49
RsaNI GTAC 1 cut(s) 48
Sau3AI GATC 2 cut(s) 61, 89
ScaI AGTACT 1 cut(s) 49
SchI GAGTC 1 cut(s) 47
SetI ASST 1 cut(s) 113
SgeI CNNG 5 cut(s) 28, 69, 77, 97, 128
TaaI ACNGT 1 cut(s) 47
TatI WGTACW 1 cut(s) 47
ZrmI AGTACT 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.