Rroxscaffold_2G00091330

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
12901343 .. 12902833
1491 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00091330.1

Sequence Viewer

Length: 288 bp
ATGGGTCTCGGATTATGGGCTAGAAGCACCAACGAAGACGAAGATGAAGCTCGGATTCGGACCAAATATGAGATTATGGGTGGAAGCACCGACGAAGAAGAAGTTTGCAACATTGAAGATGAAGTATCAATGATGCAAAACATCTCCGGCTTCTGCATTCTATACGACAACGAAATCGAAAAAAAATCTCCGATAGAGGACAGTCCCAGAATTGTCGTATTGGGATCTCATTGGACAGGCGTCGCTGTAATGTTCTCCATCTCCATGACCCAGTCTCTGTTCCGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

95

Amino Acids

10.77

Weight (kDa)

4.33

Isoelectric Point (pI)

70.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 232
AcyI GRCGYC 1 cut(s) 240
AgsI TTSAA 1 cut(s) 116
AluBI AGCT 1 cut(s) 50
AluI AGCT 1 cut(s) 50
Alw26I GTCTC 2 cut(s) 11, 279
AlwI GGATC 1 cut(s) 232
AlwNI CAGNNNCTG 1 cut(s) 277
AspS9I GGNCC 1 cut(s) 60
AvaII GGWCC 1 cut(s) 60
BbsI GAAGAC 1 cut(s) 42
BccI CCATC 1 cut(s) 266
BcoDI GTCTC 2 cut(s) 11, 279
BfaI CTAG 1 cut(s) 21
Bme18I GGWCC 1 cut(s) 60
BmgT120I GGNCC 1 cut(s) 60
BmrI ACTGGG 1 cut(s) 265
BmsI GCATC 1 cut(s) 123
BmuI ACTGGG 1 cut(s) 265
BoxI GACNNNNGTC 1 cut(s) 239
BpiI GAAGAC 1 cut(s) 42
BsaHI GRCGYC 1 cut(s) 240
BsaI GGTCTC 1 cut(s) 11
BsaWI WCCGGW 1 cut(s) 282
Bse1I ACTGG 1 cut(s) 271
BseNI ACTGG 1 cut(s) 271
BsiSI CCGG 2 cut(s) 147, 283
BslFI GGGAC 1 cut(s) 189
BsmAI GTCTC 2 cut(s) 11, 279
BsmFI GGGAC 1 cut(s) 189
BsmI GAATGC 1 cut(s) 156
Bso31I GGTCTC 1 cut(s) 11
Bsp143I GATC 1 cut(s) 224
BspPI GGATC 1 cut(s) 232
BspTNI GGTCTC 1 cut(s) 11
BsrI ACTGG 1 cut(s) 271
BssMI GATC 1 cut(s) 224
BssNI GRCGYC 1 cut(s) 240
Bst4CI ACNGT 1 cut(s) 203
BstACI GRCGYC 1 cut(s) 240
BstKTI GATC 1 cut(s) 227
BstMAI GTCTC 2 cut(s) 11, 279
BstMBI GATC 1 cut(s) 224
BstPAI GACNNNNGTC 1 cut(s) 239
BstV2I GAAGAC 1 cut(s) 42
BstX2I RGATCY 1 cut(s) 224
BstYI RGATCY 1 cut(s) 224
CaiI CAGNNNCTG 1 cut(s) 277
Cfr13I GGNCC 1 cut(s) 60
CseI GACGC 1 cut(s) 229
CviAII CATG 1 cut(s) 265
CviJI RGCY 3 cut(s) 20, 50, 150
CviKI_1 RGCY 3 cut(s) 20, 50, 150
DpnI GATC 1 cut(s) 226
DpnII GATC 1 cut(s) 224
Eco31I GGTCTC 1 cut(s) 11
Eco47I GGWCC 1 cut(s) 60
FaeI CATG 1 cut(s) 268
FaiI YATR 5 cut(s) 16, 69, 77, 163, 266
FaqI GGGAC 1 cut(s) 189
FatI CATG 1 cut(s) 264
FspBI CTAG 1 cut(s) 21
HapII CCGG 2 cut(s) 147, 283
HgaI GACGC 1 cut(s) 229
Hin1I GRCGYC 1 cut(s) 240
Hin1II CATG 1 cut(s) 268
HinfI GANTC 1 cut(s) 55
HpaII CCGG 2 cut(s) 147, 283
Hpy188I TCNGA 4 cut(s) 11, 54, 60, 192
Hpy99I CGWCG 2 cut(s) 95, 245
HpyCH4III ACNGT 1 cut(s) 203
HpyCH4V TGCA 3 cut(s) 108, 136, 156
Hsp92I GRCGYC 1 cut(s) 240
Hsp92II CATG 1 cut(s) 268
Kzo9I GATC 1 cut(s) 224
LpnPI CCDG 4 cut(s) 160, 220, 222, 284
LweI GCATC 1 cut(s) 123
MaeI CTAG 1 cut(s) 21
MalI GATC 1 cut(s) 226
MboI GATC 1 cut(s) 224
MboII GAAGA 5 cut(s) 47, 53, 107, 110, 128
MflI RGATCY 1 cut(s) 224
MluCI AATT 1 cut(s) 210
MnlI CCTC 1 cut(s) 190
MslI CAYNNNNRTG 1 cut(s) 263
MspI CCGG 2 cut(s) 147, 283
Mva1269I GAATGC 1 cut(s) 156
NdeII GATC 1 cut(s) 224
NlaIII CATG 1 cut(s) 268
PctI GAATGC 1 cut(s) 156
PfeI GAWTC 1 cut(s) 55
PflFI GACNNNGTC 1 cut(s) 271
PshAI GACNNNNGTC 1 cut(s) 239
PspPI GGNCC 1 cut(s) 60
PstNI CAGNNNCTG 1 cut(s) 277
PsuI RGATCY 1 cut(s) 224
PsyI GACNNNGTC 1 cut(s) 271
RseI CAYNNNNRTG 1 cut(s) 263
Sau3AI GATC 1 cut(s) 224
Sau96I GGNCC 1 cut(s) 60
SetI ASST 1 cut(s) 52
SfaNI GCATC 1 cut(s) 123
SgeI CNNG 8 cut(s) 20, 33, 63, 159, 219, 249, 277, 283
SinI GGWCC 1 cut(s) 60
SmiMI CAYNNNNRTG 1 cut(s) 263
Sse9I AATT 1 cut(s) 210
SspMI CTAG 1 cut(s) 21
TaaI ACNGT 1 cut(s) 203
TaqI TCGA 1 cut(s) 177
TasI AATT 1 cut(s) 210
TfiI GAWTC 1 cut(s) 55
TspDTI ATGAA 2 cut(s) 60, 135
Tth111I GACNNNGTC 1 cut(s) 271
VpaK11BI GGWCC 1 cut(s) 60
XspI CTAG 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.