Rroxscaffold_3G00247160

Belongs to the IPP transferase family

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
40517322 .. 40521928
4607 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00247160.1

Sequence Viewer

Length: 258 bp
ATGACATTAGTTAATTCCTCTGCTGATGTTGTGGAGGAAGTTAAATCAAAGGAATTGGACTATGACTTCATTTGCTTTTTCCTCTCAAACCAAAGGGTTGATCTATACAGATCAATTGATTGGCGATGTGAAGATATGGTGTCAGGAACTGATGGTATCTTGTCTGAGGCCAGATGGCTTCTTGATGCGGGTCTTATTCCAAATTATTCCAATTCAGCAACCAGAGCAATAGGCTATGGAGTATTTATTAGTGTGTAG

Protein Analysis

85

Amino Acids

9.58

Weight (kDa)

4.29

Isoelectric Point (pI)

27.38

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
IPPT PF01715 16 - 83 1.6e-08 IPP transferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 188
AlwNI CAGNNNCTG 1 cut(s) 149
AoxI GGCC 1 cut(s) 168
BccI CCATC 2 cut(s) 146, 168
BmsI GCATC 1 cut(s) 175
BseMII CTCAG 1 cut(s) 156
BshFI GGCC 1 cut(s) 170
BsnI GGCC 1 cut(s) 170
Bsp143I GATC 2 cut(s) 100, 110
BspACI CCGC 1 cut(s) 188
BspANI GGCC 1 cut(s) 170
BspCNI CTCAG 1 cut(s) 157
BssMI GATC 2 cut(s) 100, 110
BstDEI CTNAG 1 cut(s) 165
BstKTI GATC 2 cut(s) 103, 113
BstMBI GATC 2 cut(s) 100, 110
BstMWI GCNNNNNNNGC 1 cut(s) 224
BsuRI GGCC 1 cut(s) 170
BtgZI GCGATG 1 cut(s) 139
CaiI CAGNNNCTG 1 cut(s) 149
CviJI RGCY 3 cut(s) 170, 178, 234
CviKI_1 RGCY 3 cut(s) 170, 178, 234
DdeI CTNAG 1 cut(s) 165
DpnI GATC 2 cut(s) 102, 112
DpnII GATC 2 cut(s) 100, 110
FaiI YATR 4 cut(s) 63, 106, 137, 237
FauI CCCGC 1 cut(s) 181
HaeIII GGCC 1 cut(s) 170
Hpy188I TCNGA 1 cut(s) 166
Hpy188III TCNNGA 2 cut(s) 144, 182
HpyF10VI GCNNNNNNNGC 1 cut(s) 224
HpyF3I CTNAG 1 cut(s) 165
Kzo9I GATC 2 cut(s) 100, 110
LpnPI CCDG 3 cut(s) 129, 184, 235
LweI GCATC 1 cut(s) 175
MalI GATC 2 cut(s) 102, 112
MboI GATC 2 cut(s) 100, 110
MboII GAAGA 1 cut(s) 143
MfeI CAATTG 1 cut(s) 114
MluCI AATT 5 cut(s) 13, 53, 114, 202, 211
MnlI CCTC 4 cut(s) 28, 28, 92, 160
MseI TTAA 2 cut(s) 12, 42
MunI CAATTG 1 cut(s) 114
MwoI GCNNNNNNNGC 1 cut(s) 224
NdeII GATC 2 cut(s) 100, 110
PstNI CAGNNNCTG 1 cut(s) 149
SaqAI TTAA 2 cut(s) 12, 42
Sau3AI GATC 2 cut(s) 100, 110
SfaNI GCATC 1 cut(s) 175
SgeI CNNG 6 cut(s) 156, 172, 183, 194, 201, 234
Sse9I AATT 5 cut(s) 13, 53, 114, 202, 211
SsiI CCGC 1 cut(s) 188
TasI AATT 5 cut(s) 13, 53, 114, 202, 211
Tru1I TTAA 2 cut(s) 12, 42
Tru9I TTAA 2 cut(s) 12, 42
TspDTI ATGAA 1 cut(s) 58
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.