Rroxscaffold_7G00168600

Histidine protein methyltransferase 1 homolog

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
9457359 .. 9460303
2945 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00168600.1

Sequence Viewer

Length: 543 bp
ATGCCAAGGTTATTGAGAAATATGTCATCAACATCGAGGTTGACACCGACGTCGAGGTTAGCATCGAGGTTATTGCGAAAGAAGTCATCGACGTCGAGGTTGGCGCCGACATCGAGGATCGACACCGACGTGGAGGTTAGCGCCGAGGTTATCGAGAGCGACATCATCAACATCGAGGCCGGCATTGTAGTTATTAAGAAGGACGTCACCGATGTCGAGGCCGGTGCCGAGGTTATTGAGAAAAAGTCACGTACCGTCGAGGTTGACATCGCGTACATTAAAGAAGACGGCGTCGACGTCGAGGACGACATCACATTCAGTTACTATGCAGGGTATCCGAAATCTTACGATAGCTCTATTGATCTTGTTAATGTCCCGAAGCATGAGATTCAAGATGGGCAACCGAGCTTCGGAGGAAAAAGGGTACTTAAGCTGGGTTGTAGCTATGGCCTTCGAGGAATTTTTGCTTGTTTGAAGGTATTTAAGTCCCCAAGTACCCATCATGCCTCCGGATCCTACCCCATAGTGAGTCTTGATGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

180

Amino Acids

19.76

Weight (kDa)

5.97

Isoelectric Point (pI)

52.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 49
AatII GACGTC 4 cut(s) 53, 95, 207, 300
AccB1I GGYRCC 2 cut(s) 103, 224
AccI GTMKAC 1 cut(s) 294
AccII CGCG 1 cut(s) 272
AccIII TCCGGA 1 cut(s) 509
AclWI GGATC 3 cut(s) 125, 507, 520
AcsI RAATTY 1 cut(s) 459
AcyI GRCGYC 6 cut(s) 50, 92, 104, 204, 291, 297
AfaI GTAC 4 cut(s) 253, 275, 426, 496
AfiI CCNNNNNNNGG 1 cut(s) 410
AflII CTTAAG 1 cut(s) 428
AgsI TTSAA 2 cut(s) 392, 475
AjiI CACGTC 1 cut(s) 130
AleI CACNNNNGTG 1 cut(s) 128
AluBI AGCT 4 cut(s) 354, 408, 433, 444
AluI AGCT 4 cut(s) 354, 408, 433, 444
AlwI GGATC 3 cut(s) 125, 507, 520
Aor13HI TCCGGA 1 cut(s) 509
AoxI GGCC 3 cut(s) 177, 219, 448
ApoI RAATTY 1 cut(s) 459
AspLEI GCGC 2 cut(s) 106, 143
AsuHPI GGTGA 1 cut(s) 199
BamHI GGATCC 1 cut(s) 512
BanI GGYRCC 2 cut(s) 103, 224
BbsI GAAGAC 1 cut(s) 291
BccI CCATC 2 cut(s) 389, 507
BceAI ACGGC 1 cut(s) 304
BcgI CGANNNNNNTGC 4 cut(s) 55, 89, 206, 240
BciVI GTATCC 1 cut(s) 345
BfoI RGCGCY 2 cut(s) 107, 144
BfrI CTTAAG 1 cut(s) 428
BfuI GTATCC 1 cut(s) 345
BmgBI CACGTC 1 cut(s) 130
BmiI GGNNCC 3 cut(s) 105, 226, 514
BmsI GCATC 1 cut(s) 71
BpiI GAAGAC 1 cut(s) 291
BsaAI YACGTR 1 cut(s) 251
BsaHI GRCGYC 6 cut(s) 50, 92, 104, 204, 291, 297
BsaJI CCNNGG 3 cut(s) 5, 144, 228
BsaWI WCCGGW 1 cut(s) 509
Bsc4I CCNNNNNNNGG 1 cut(s) 410
Bse118I RCCGGY 2 cut(s) 179, 221
BseAI TCCGGA 1 cut(s) 509
BseDI CCNNGG 3 cut(s) 5, 144, 228
BseLI CCNNNNNNNGG 1 cut(s) 410
BseYI CCCAGC 1 cut(s) 433
Bsh1236I CGCG 1 cut(s) 272
BshFI GGCC 3 cut(s) 179, 221, 450
BshNI GGYRCC 2 cut(s) 103, 224
BsiSI CCGG 3 cut(s) 180, 222, 510
BslFI GGGAC 2 cut(s) 359, 472
BslI CCNNNNNNNGG 1 cut(s) 410
BsmFI GGGAC 2 cut(s) 359, 472
BsnI GGCC 3 cut(s) 179, 221, 450
Bsp13I TCCGGA 1 cut(s) 509
Bsp143I GATC 3 cut(s) 117, 361, 512
BspANI GGCC 3 cut(s) 179, 221, 450
BspEI TCCGGA 1 cut(s) 509
BspFNI CGCG 1 cut(s) 272
BspLI GGNNCC 3 cut(s) 105, 226, 514
BspPI GGATC 3 cut(s) 125, 507, 520
BspT107I GGYRCC 2 cut(s) 103, 224
BspTI CTTAAG 1 cut(s) 428
BsrFI RCCGGY 2 cut(s) 179, 221
BssAI RCCGGY 2 cut(s) 179, 221
BssECI CCNNGG 3 cut(s) 5, 144, 228
BssMI GATC 3 cut(s) 117, 361, 512
BssNI GRCGYC 6 cut(s) 50, 92, 104, 204, 291, 297
BssT1I CCWWGG 1 cut(s) 5
Bst4CI ACNGT 1 cut(s) 256
BstACI GRCGYC 6 cut(s) 50, 92, 104, 204, 291, 297
BstAFI CTTAAG 1 cut(s) 428
BstBAI YACGTR 1 cut(s) 251
BstC8I GCNNGC 1 cut(s) 181
BstFNI CGCG 1 cut(s) 272
BstH2I RGCGCY 2 cut(s) 107, 144
BstHHI GCGC 2 cut(s) 106, 143
BstKTI GATC 3 cut(s) 120, 364, 515
BstMBI GATC 3 cut(s) 117, 361, 512
BstUI CGCG 1 cut(s) 272
BstV2I GAAGAC 1 cut(s) 291
BstX2I RGATCY 1 cut(s) 512
BstYI RGATCY 1 cut(s) 512
BsuI GTATCC 1 cut(s) 345
BsuRI GGCC 3 cut(s) 179, 221, 450
BtgZI GCGATG 1 cut(s) 253
BtrI CACGTC 1 cut(s) 130
Cac8I GCNNGC 1 cut(s) 181
CfoI GCGC 2 cut(s) 106, 143
Cfr10I RCCGGY 2 cut(s) 179, 221
CseI GACGC 1 cut(s) 280
Csp6I GTAC 4 cut(s) 252, 274, 425, 495
CviAII CATG 2 cut(s) 383, 503
CviJI RGCY 7 cut(s) 179, 221, 354, 408, 433, 444, 450
CviKI_1 RGCY 7 cut(s) 179, 221, 354, 408, 433, 444, 450
CviQI GTAC 4 cut(s) 252, 274, 425, 495
DinI GGCGCC 1 cut(s) 105
DpnI GATC 3 cut(s) 119, 363, 514
DpnII GATC 3 cut(s) 117, 361, 512
DrdI GACNNNNNNGTC 1 cut(s) 49
DseDI GACNNNNNNGTC 1 cut(s) 49
Eco130I CCWWGG 1 cut(s) 5
EcoT14I CCWWGG 1 cut(s) 5
EgeI GGCGCC 1 cut(s) 105
EheI GGCGCC 1 cut(s) 105
ErhI CCWWGG 1 cut(s) 5
FaeI CATG 2 cut(s) 386, 506
FaiI YATR 6 cut(s) 23, 327, 384, 447, 504, 524
FaqI GGGAC 2 cut(s) 359, 472
FatI CATG 2 cut(s) 382, 502
FblI GTMKAC 1 cut(s) 294
GlaI GCGC 2 cut(s) 105, 142
GsaI CCCAGC 1 cut(s) 437
HaeII RGCGCY 2 cut(s) 107, 144
HaeIII GGCC 3 cut(s) 179, 221, 450
HapII CCGG 3 cut(s) 180, 222, 510
HgaI GACGC 1 cut(s) 280
HhaI GCGC 2 cut(s) 106, 143
Hin1I GRCGYC 6 cut(s) 50, 92, 104, 204, 291, 297
Hin1II CATG 2 cut(s) 386, 506
Hin6I GCGC 2 cut(s) 104, 141
HinP1I GCGC 2 cut(s) 104, 141
HincII GTYRAC 3 cut(s) 42, 265, 295
HindII GTYRAC 3 cut(s) 42, 265, 295
HinfI GANTC 2 cut(s) 388, 529
HpaII CCGG 3 cut(s) 180, 222, 510
HphI GGTGA 1 cut(s) 199
Hpy166II GTNNAC 3 cut(s) 42, 265, 295
Hpy188I TCNGA 2 cut(s) 339, 413
Hpy188III TCNNGA 5 cut(s) 154, 376, 392, 510, 533
Hpy8I GTNNAC 3 cut(s) 42, 265, 295
Hpy99I CGWCG 9 cut(s) 52, 55, 94, 97, 131, 260, 296, 299, 302
HpyAV CCTTC 3 cut(s) 193, 461, 469
HpyCH4III ACNGT 1 cut(s) 256
HpyCH4IV ACGT 6 cut(s) 50, 92, 129, 204, 250, 297
HpyCH4V TGCA 1 cut(s) 329
HpySE526I ACGT 6 cut(s) 50, 92, 129, 204, 250, 297
Hsp92I GRCGYC 6 cut(s) 50, 92, 104, 204, 291, 297
Hsp92II CATG 2 cut(s) 386, 506
HspAI GCGC 2 cut(s) 104, 141
KasI GGCGCC 1 cut(s) 103
Kpn2I TCCGGA 1 cut(s) 509
KroI GCCGGC 1 cut(s) 179
KroNI GCCGGC 1 cut(s) 181
Kzo9I GATC 3 cut(s) 117, 361, 512
LpnPI CCDG 5 cut(s) 193, 235, 315, 419, 523
LweI GCATC 1 cut(s) 71
MaeII ACGT 6 cut(s) 50, 92, 129, 204, 250, 297
MaeIII GTNAC 3 cut(s) 205, 246, 320
MalI GATC 3 cut(s) 119, 363, 514
MboI GATC 3 cut(s) 117, 361, 512
MboII GAAGA 1 cut(s) 296
MflI RGATCY 1 cut(s) 512
MluCI AATT 1 cut(s) 459
Mly113I GGCGCC 1 cut(s) 104
MlyI GAGTC 1 cut(s) 538
MroI TCCGGA 1 cut(s) 509
MroNI GCCGGC 1 cut(s) 179
MseI TTAA 5 cut(s) 195, 279, 369, 429, 483
MslI CAYNNNNRTG 1 cut(s) 128
MspCI CTTAAG 1 cut(s) 428
MspI CCGG 3 cut(s) 180, 222, 510
MvnI CGCG 1 cut(s) 272
NaeI GCCGGC 1 cut(s) 181
NarI GGCGCC 1 cut(s) 104
NdeII GATC 3 cut(s) 117, 361, 512
NgoMIV GCCGGC 1 cut(s) 179
NlaIII CATG 2 cut(s) 386, 506
NlaIV GGNNCC 3 cut(s) 105, 226, 514
NmeAIII GCCGAG 2 cut(s) 169, 253
NmuCI GTSAC 2 cut(s) 205, 246
OliI CACNNNNGTG 1 cut(s) 128
PcsI WCGNNNNNNNCGW 3 cut(s) 126, 294, 303
PdiI GCCGGC 1 cut(s) 181
PfeI GAWTC 1 cut(s) 388
PflFI GACNNNGTC 1 cut(s) 290
PleI GAGTC 1 cut(s) 537
PluTI GGCGCC 1 cut(s) 107
PpsI GAGTC 1 cut(s) 537
Ppu21I YACGTR 1 cut(s) 251
PspFI CCCAGC 1 cut(s) 433
PspN4I GGNNCC 3 cut(s) 105, 226, 514
PsuI RGATCY 1 cut(s) 512
PsyI GACNNNGTC 1 cut(s) 290
RsaI GTAC 4 cut(s) 253, 275, 426, 496
RsaNI GTAC 4 cut(s) 252, 274, 425, 495
RseI CAYNNNNRTG 1 cut(s) 128
SalI GTCGAC 1 cut(s) 293
SaqAI TTAA 5 cut(s) 195, 279, 369, 429, 483
Sau3AI GATC 3 cut(s) 117, 361, 512
SchI GAGTC 1 cut(s) 538
SfaNI GCATC 1 cut(s) 71
SfoI GGCGCC 1 cut(s) 105
SgrDI CGTCGACG 1 cut(s) 293
SmiMI CAYNNNNRTG 1 cut(s) 128
SmlI CTYRAG 1 cut(s) 428
SmoI CTYRAG 1 cut(s) 428
Sse9I AATT 1 cut(s) 459
SspDI GGCGCC 1 cut(s) 103
StyI CCWWGG 1 cut(s) 5
TaaI ACNGT 1 cut(s) 256
TaiI ACGT 6 cut(s) 53, 95, 132, 207, 253, 300
TasI AATT 1 cut(s) 459
TfiI GAWTC 1 cut(s) 388
Tru1I TTAA 5 cut(s) 195, 279, 369, 429, 483
Tru9I TTAA 5 cut(s) 195, 279, 369, 429, 483
TseFI GTSAC 2 cut(s) 205, 246
Tsp45I GTSAC 2 cut(s) 205, 246
Tth111I GACNNNGTC 1 cut(s) 290
Vha464I CTTAAG 1 cut(s) 428
XapI RAATTY 1 cut(s) 459
XmiI GTMKAC 1 cut(s) 294
ZraI GACGTC 4 cut(s) 51, 93, 205, 298
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.