Rorug01G0187600
ERF Family

Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
OG0004872
Physical Location & Seq
Reverse (-)
25949208 .. 25951310
2103 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0187600.1

Sequence Viewer

Length: 345 bp
ATGGGAATCTTTGCTATGCACCTGGTGATATGGCAACTCTTAAGGAATTTGAAAATCAAGACTGGCACTTGTAAACGCCTCGTTAAGGAGTTTCATTCTTATGAGAAAGAGGTTGAGAGAGAGGCTGCGAAAACAGCAGACATGAAGGGGAAAGGAGCTGATCCTTATGACCTCAAGCAACAGGAAAATGTGCTTGCTGAATCAAGGATGATGATTCCCGATTGTCAAAAGCGCCTGGAGGCTGAGTTGGAAGAAGAGTTGAACCAGAAGGAAGGCCCTGAAATTGAAGAAGCTCGGACCATTATTGCAGAAGTTGATAAGTTGTTCCAGACAACGGAAGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Kinesin Malectin

Protein Analysis

114

Amino Acids

13.24

Weight (kDa)

5.07

Isoelectric Point (pI)

37.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TBCA PF02970 14 - 91 1.4e-26 Tubulin binding cofactor A
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 155
AcsI RAATTY 1 cut(s) 46
AdeI CACNNNGTG 1 cut(s) 25
AfiI CCNNNNNNNGG 2 cut(s) 85, 334
AflII CTTAAG 1 cut(s) 40
AgsI TTSAA 3 cut(s) 52, 262, 287
AjnI CCWGG 2 cut(s) 21, 234
AluBI AGCT 2 cut(s) 158, 293
AluI AGCT 2 cut(s) 158, 293
AlwI GGATC 1 cut(s) 155
AoxI GGCC 1 cut(s) 274
ApeKI GCWGC 1 cut(s) 125
ApoI RAATTY 1 cut(s) 46
AspLEI GCGC 1 cut(s) 234
AspS9I GGNCC 2 cut(s) 275, 297
AsuHPI GGTGA 1 cut(s) 37
AvaII GGWCC 1 cut(s) 297
BbvI GCAGC 1 cut(s) 112
BciT130I CCWGG 2 cut(s) 23, 236
BfaI CTAG 1 cut(s) 343
BfoI RGCGCY 1 cut(s) 235
BfrI CTTAAG 1 cut(s) 40
BisI GCNGC 1 cut(s) 126
BlsI GCNGC 1 cut(s) 127
Bme1390I CCNGG 2 cut(s) 23, 236
Bme18I GGWCC 1 cut(s) 297
BmgT120I GGNCC 2 cut(s) 275, 297
BmrFI CCNGG 2 cut(s) 23, 236
BpmI CTGGAG 1 cut(s) 257
BpuEI CTTGAG 1 cut(s) 158
BsaXI ACNNNNNCTCC 2 cut(s) 230, 260
Bsc4I CCNNNNNNNGG 2 cut(s) 85, 334
Bse1I ACTGG 1 cut(s) 67
BseBI CCWGG 2 cut(s) 23, 236
BseGI GGATG 1 cut(s) 213
BseLI CCNNNNNNNGG 2 cut(s) 85, 334
BseMII CTCAG 1 cut(s) 234
BseNI ACTGG 1 cut(s) 67
BseXI GCAGC 1 cut(s) 112
BshFI GGCC 1 cut(s) 276
BslI CCNNNNNNNGG 2 cut(s) 85, 334
BsnI GGCC 1 cut(s) 276
Bsp143I GATC 1 cut(s) 160
BspANI GGCC 1 cut(s) 276
BspCNI CTCAG 1 cut(s) 235
BspPI GGATC 1 cut(s) 155
BspTI CTTAAG 1 cut(s) 40
BsrI ACTGG 1 cut(s) 67
BssMI GATC 1 cut(s) 160
Bst2UI CCWGG 2 cut(s) 23, 236
Bst6I CTCTTC 1 cut(s) 249
BstAFI CTTAAG 1 cut(s) 40
BstC8I GCNNGC 1 cut(s) 195
BstDEI CTNAG 1 cut(s) 243
BstENI CCTNNNNNAGG 1 cut(s) 83
BstF5I GGATG 1 cut(s) 213
BstH2I RGCGCY 1 cut(s) 235
BstHHI GCGC 1 cut(s) 234
BstKTI GATC 1 cut(s) 163
BstMBI GATC 1 cut(s) 160
BstMWI GCNNNNNNNGC 1 cut(s) 134
BstNI CCWGG 2 cut(s) 23, 236
BstSCI CCNGG 2 cut(s) 21, 234
BstV1I GCAGC 1 cut(s) 112
BsuRI GGCC 1 cut(s) 276
BtsCI GGATG 1 cut(s) 213
Cac8I GCNNGC 1 cut(s) 195
CfoI GCGC 1 cut(s) 234
Cfr13I GGNCC 2 cut(s) 275, 297
CsiI ACCWGGT 1 cut(s) 21
CviAII CATG 1 cut(s) 142
CviJI RGCY 5 cut(s) 125, 158, 242, 276, 293
CviKI_1 RGCY 5 cut(s) 125, 158, 242, 276, 293
DdeI CTNAG 1 cut(s) 243
DpnI GATC 1 cut(s) 162
DpnII GATC 1 cut(s) 160
DraIII CACNNNGTG 1 cut(s) 25
Eam1104I CTCTTC 1 cut(s) 249
EarI CTCTTC 1 cut(s) 249
Eco47I GGWCC 1 cut(s) 297
EcoNI CCTNNNNNAGG 1 cut(s) 83
EcoO109I RGGNCCY 1 cut(s) 275
EcoRII CCWGG 2 cut(s) 21, 234
FaeI CATG 1 cut(s) 145
FaiI YATR 5 cut(s) 17, 31, 102, 143, 168
FatI CATG 1 cut(s) 141
Fnu4HI GCNGC 1 cut(s) 126
FokI GGATG 1 cut(s) 220
Fsp4HI GCNGC 1 cut(s) 126
FspBI CTAG 1 cut(s) 343
GlaI GCGC 1 cut(s) 233
GluI GCNGC 1 cut(s) 126
GsuI CTGGAG 1 cut(s) 257
HaeII RGCGCY 1 cut(s) 235
HaeIII GGCC 1 cut(s) 276
HhaI GCGC 1 cut(s) 234
Hin1II CATG 1 cut(s) 145
Hin6I GCGC 1 cut(s) 232
HinP1I GCGC 1 cut(s) 232
HinfI GANTC 3 cut(s) 6, 200, 214
HphI GGTGA 1 cut(s) 37
Hpy166II GTNNAC 1 cut(s) 74
Hpy188I TCNGA 1 cut(s) 297
Hpy188III TCNNGA 3 cut(s) 58, 218, 328
Hpy8I GTNNAC 1 cut(s) 74
HpyAV CCTTC 3 cut(s) 139, 262, 266
HpyCH4V TGCA 2 cut(s) 19, 308
HpyF10VI GCNNNNNNNGC 1 cut(s) 134
HpyF3I CTNAG 1 cut(s) 243
Hsp92II CATG 1 cut(s) 145
HspAI GCGC 1 cut(s) 232
Kzo9I GATC 1 cut(s) 160
LmnI GCTCC 1 cut(s) 155
LpnPI CCDG 9 cut(s) 8, 35, 48, 167, 221, 248, 278, 291, 341
Lsp1109I GCAGC 1 cut(s) 112
MabI ACCWGGT 1 cut(s) 21
MaeI CTAG 1 cut(s) 343
MalI GATC 1 cut(s) 162
MboI GATC 1 cut(s) 160
MboII GAAGA 3 cut(s) 263, 266, 299
MluCI AATT 2 cut(s) 46, 282
MmeI TCCRAC 1 cut(s) 228
MnlI CCTC 5 cut(s) 89, 103, 115, 182, 232
MseI TTAA 2 cut(s) 41, 84
MslI CAYNNNNRTG 1 cut(s) 99
MspCI CTTAAG 1 cut(s) 40
MspR9I CCNGG 2 cut(s) 23, 236
MvaI CCWGG 2 cut(s) 23, 236
MwoI GCNNNNNNNGC 1 cut(s) 134
NdeII GATC 1 cut(s) 160
NlaIII CATG 1 cut(s) 145
PfeI GAWTC 3 cut(s) 6, 200, 214
PkrI GCNGC 1 cut(s) 127
Psp6I CCWGG 2 cut(s) 21, 234
PspGI CCWGG 2 cut(s) 21, 234
PspPI GGNCC 2 cut(s) 275, 297
RseI CAYNNNNRTG 1 cut(s) 99
SaqAI TTAA 2 cut(s) 41, 84
SatI GCNGC 1 cut(s) 126
Sau3AI GATC 1 cut(s) 160
Sau96I GGNCC 2 cut(s) 275, 297
ScrFI CCNGG 2 cut(s) 23, 236
SetI ASST 5 cut(s) 24, 114, 160, 174, 295
SexAI ACCWGGT 1 cut(s) 21
SinI GGWCC 1 cut(s) 297
SmiMI CAYNNNNRTG 1 cut(s) 99
SmlI CTYRAG 2 cut(s) 40, 173
SmoI CTYRAG 2 cut(s) 40, 173
Sse9I AATT 2 cut(s) 46, 282
SspMI CTAG 1 cut(s) 343
StyD4I CCNGG 2 cut(s) 21, 234
TasI AATT 2 cut(s) 46, 282
TfiI GAWTC 3 cut(s) 6, 200, 214
Tru1I TTAA 2 cut(s) 41, 84
Tru9I TTAA 2 cut(s) 41, 84
TseI GCWGC 1 cut(s) 125
TspDTI ATGAA 2 cut(s) 83, 158
Vha464I CTTAAG 1 cut(s) 40
VpaK11BI GGWCC 1 cut(s) 297
XagI CCTNNNNNAGG 1 cut(s) 83
XapI RAATTY 1 cut(s) 46
XspI CTAG 1 cut(s) 343
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.