Rorug02G0528500

Vesicle transport V-snare

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
65831670 .. 65832369
700 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0528500.1

Sequence Viewer

Length: 315 bp
ATGGGATTACTTGGAGGCTCATCAGGTTCTGAAGATGAGGAAGAGAGAAGATCAGGATCAGAAAGATCAGAAGGATCAGAAGGATCAGAAAGATCAGAAGGATCGGAAAGATCAGGATCAGAAGATGAAGATGAAGATGAAGATGAAGAGGAGGAGGAAGATGAAGACGAAGATGAAGATGAAGATGAGAAAGACTCTGAAGGTGAAGAAGAGGAAGATGGGAAAGGGAAGAAGAAGAAGAAGAAGAAGGGAATGAGATCTAGGCTCATGTCGAAGGCAAAAAAATCAGTTTTTAAGAAAGTCATTGGCTTGTAA

Protein Analysis

104

Amino Acids

11.6

Weight (kDa)

4.36

Isoelectric Point (pI)

105.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 5 cut(s) 64, 82, 91, 109, 124
AcuI CTGAAG 2 cut(s) 51, 219
AlwI GGATC 5 cut(s) 64, 82, 91, 109, 124
AlwNI CAGNNNCTG 1 cut(s) 29
AsuHPI GGTGA 1 cut(s) 215
BbsI GAAGAC 1 cut(s) 171
BccI CCATC 1 cut(s) 212
BfaI CTAG 1 cut(s) 261
BglII AGATCT 1 cut(s) 257
BpiI GAAGAC 1 cut(s) 171
BplI GAGNNNNNCTC 2 cut(s) 179, 211
BsaBI GATNNNNATC 2 cut(s) 55, 115
Bse8I GATNNNNATC 2 cut(s) 55, 115
BseJI GATNNNNATC 2 cut(s) 55, 115
BseRI GAGGAG 2 cut(s) 164, 167
BspPI GGATC 5 cut(s) 64, 82, 91, 109, 124
Bst6I CTCTTC 3 cut(s) 36, 141, 204
BstV2I GAAGAC 1 cut(s) 171
BstX2I RGATCY 1 cut(s) 257
BstYI RGATCY 1 cut(s) 257
CaiI CAGNNNCTG 1 cut(s) 29
CviAII CATG 1 cut(s) 268
CviJI RGCY 3 cut(s) 18, 265, 309
CviKI_1 RGCY 3 cut(s) 18, 265, 309
Eam1104I CTCTTC 3 cut(s) 36, 141, 204
EarI CTCTTC 3 cut(s) 36, 141, 204
Eco57I CTGAAG 2 cut(s) 51, 219
FaeI CATG 1 cut(s) 271
FaiI YATR 1 cut(s) 269
FatI CATG 1 cut(s) 267
FspBI CTAG 1 cut(s) 261
Hin1II CATG 1 cut(s) 271
HinfI GANTC 1 cut(s) 194
HphI GGTGA 1 cut(s) 215
Hpy188I TCNGA 9 cut(s) 31, 61, 70, 79, 88, 97, 106, 121, 199
Hpy188III TCNNGA 2 cut(s) 54, 114
HpyAV CCTTC 6 cut(s) 65, 74, 92, 194, 241, 268
Hsp92II CATG 1 cut(s) 271
LpnPI CCDG 3 cut(s) 9, 39, 99
MaeI CTAG 1 cut(s) 261
MflI RGATCY 1 cut(s) 257
MlyI GAGTC 1 cut(s) 188
MnlI CCTC 6 cut(s) 8, 31, 142, 145, 148, 205
MseI TTAA 1 cut(s) 294
NlaIII CATG 1 cut(s) 271
PleI GAGTC 1 cut(s) 188
PpsI GAGTC 1 cut(s) 188
PstNI CAGNNNCTG 1 cut(s) 29
PsuI RGATCY 1 cut(s) 257
SaqAI TTAA 1 cut(s) 294
SchI GAGTC 1 cut(s) 188
SetI ASST 2 cut(s) 28, 205
SgeI CNNG 6 cut(s) 23, 36, 66, 126, 273, 280
SspMI CTAG 1 cut(s) 261
TaqI TCGA 1 cut(s) 272
Tru1I TTAA 1 cut(s) 294
Tru9I TTAA 1 cut(s) 294
TspDTI ATGAA 7 cut(s) 141, 147, 153, 159, 177, 189, 195
XspI CTAG 1 cut(s) 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.