Rh1AG004700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0004259
Physical Location & Seq
Forward (+)
690743 .. 691042
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG004700.1

Sequence Viewer

Length: 300 bp
ATGGAGTATGGTTTCTTCGATCAATATGGCACCTTCCTTGATAGTAATCATGAAACTGATTACTTTCGCCTGCAAGACTTCTTTGTTCACGATGACGACGATCCAGGGTTGGATGATGATGATGAGGTGAAAGCTGATGGAAGCAGGGACTGTCTTGCAGTCATCAACCGCCTTGTCCCTTGCCACTTCAACAGCAGTATCAATGACCTGATACATGTTTGCATAAAACAAGGAGGAACCAACATTATAAGCATGTTAACACCAAACATGTTTTGTGATTATGAAAGGTTTAACCCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

99

Amino Acids

11.45

Weight (kDa)

4.14

Isoelectric Point (pI)

30.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 248
AccB1I GGYRCC 1 cut(s) 29
AciI CCGC 1 cut(s) 169
AclWI GGATC 1 cut(s) 95
AflIII ACRYGT 2 cut(s) 214, 267
AgsI TTSAA 1 cut(s) 190
AjnI CCWGG 1 cut(s) 103
AluBI AGCT 1 cut(s) 134
AluI AGCT 1 cut(s) 134
AlwI GGATC 1 cut(s) 95
AlwNI CAGNNNCTG 1 cut(s) 150
AsuHPI GGTGA 1 cut(s) 139
BaeI ACNNNNGTAYC 2 cut(s) 181, 214
BanI GGYRCC 1 cut(s) 29
BarI GAAGNNNNNNTAC 1 cut(s) 31
BccI CCATC 1 cut(s) 131
BciT130I CCWGG 1 cut(s) 105
Bme1390I CCNGG 1 cut(s) 105
BmiI GGNNCC 2 cut(s) 31, 238
BmrFI CCNGG 1 cut(s) 105
BsaBI GATNNNNATC 1 cut(s) 45
BsaJI CCNNGG 1 cut(s) 104
Bse8I GATNNNNATC 1 cut(s) 45
BseBI CCWGG 1 cut(s) 105
BseDI CCNNGG 1 cut(s) 104
BseGI GGATG 1 cut(s) 118
BseJI GATNNNNATC 1 cut(s) 45
BshNI GGYRCC 1 cut(s) 29
BslFI GGGAC 2 cut(s) 161, 161
BsmFI GGGAC 2 cut(s) 161, 161
Bsp143I GATC 2 cut(s) 19, 100
BspACI CCGC 1 cut(s) 169
BspHI TCATGA 1 cut(s) 49
BspLI GGNNCC 2 cut(s) 31, 238
BspPI GGATC 1 cut(s) 95
BspT107I GGYRCC 1 cut(s) 29
BssECI CCNNGG 1 cut(s) 104
BssMI GATC 2 cut(s) 19, 100
Bst2UI CCWGG 1 cut(s) 105
Bst4CI ACNGT 1 cut(s) 152
BstC8I GCNNGC 1 cut(s) 71
BstF5I GGATG 1 cut(s) 118
BstKTI GATC 2 cut(s) 22, 103
BstMBI GATC 2 cut(s) 19, 100
BstNI CCWGG 1 cut(s) 105
BstNSI RCATGY 3 cut(s) 218, 256, 271
BstSCI CCNGG 1 cut(s) 103
BtsCI GGATG 1 cut(s) 118
Cac8I GCNNGC 1 cut(s) 71
CaiI CAGNNNCTG 1 cut(s) 150
CciI TCATGA 1 cut(s) 49
CviAII CATG 4 cut(s) 50, 215, 253, 268
CviJI RGCY 1 cut(s) 134
CviKI_1 RGCY 1 cut(s) 134
DpnI GATC 2 cut(s) 21, 102
DpnII GATC 2 cut(s) 19, 100
EcoRII CCWGG 1 cut(s) 103
FaeI CATG 4 cut(s) 53, 218, 256, 271
FaiI YATR 9 cut(s) 9, 27, 51, 216, 224, 248, 254, 269, 282
FaqI GGGAC 2 cut(s) 161, 161
FatI CATG 4 cut(s) 49, 214, 252, 267
FokI GGATG 1 cut(s) 125
Hin1II CATG 4 cut(s) 53, 218, 256, 271
HincII GTYRAC 1 cut(s) 258
HindII GTYRAC 1 cut(s) 258
HpaI GTTAAC 1 cut(s) 258
HphI GGTGA 1 cut(s) 139
Hpy166II GTNNAC 2 cut(s) 88, 258
Hpy188III TCNNGA 2 cut(s) 50, 89
Hpy8I GTNNAC 2 cut(s) 88, 258
Hpy99I CGWCG 1 cut(s) 101
HpyAV CCTTC 1 cut(s) 43
HpyCH4III ACNGT 1 cut(s) 152
HpyCH4V TGCA 3 cut(s) 73, 158, 222
Hsp92II CATG 4 cut(s) 53, 218, 256, 271
KspAI GTTAAC 1 cut(s) 258
Kzo9I GATC 2 cut(s) 19, 100
LpnPI CCDG 5 cut(s) 83, 90, 117, 130, 221
MalI GATC 2 cut(s) 21, 102
MboI GATC 2 cut(s) 19, 100
MboII GAAGA 1 cut(s) 7
MmeI TCCRAC 1 cut(s) 90
MnlI CCTC 2 cut(s) 118, 227
MseI TTAA 2 cut(s) 257, 291
MspR9I CCNGG 1 cut(s) 105
MvaI CCWGG 1 cut(s) 105
NdeII GATC 2 cut(s) 19, 100
NlaIII CATG 4 cut(s) 53, 218, 256, 271
NlaIV GGNNCC 2 cut(s) 31, 238
NspI RCATGY 3 cut(s) 218, 256, 271
PagI TCATGA 1 cut(s) 49
PciI ACATGT 2 cut(s) 214, 267
PcsI WCGNNNNNNNCGW 1 cut(s) 96
PscI ACATGT 2 cut(s) 214, 267
PsiI TTATAA 1 cut(s) 248
Psp6I CCWGG 1 cut(s) 103
PspGI CCWGG 1 cut(s) 103
PspN4I GGNNCC 2 cut(s) 31, 238
PstNI CAGNNNCTG 1 cut(s) 150
SaqAI TTAA 2 cut(s) 257, 291
Sau3AI GATC 2 cut(s) 19, 100
ScrFI CCNGG 1 cut(s) 105
SetI ASST 5 cut(s) 35, 129, 136, 210, 290
SsiI CCGC 1 cut(s) 169
StyD4I CCNGG 1 cut(s) 103
TaaI ACNGT 1 cut(s) 152
TaqI TCGA 1 cut(s) 18
Tru1I TTAA 2 cut(s) 257, 291
Tru9I TTAA 2 cut(s) 257, 291
TspDTI ATGAA 2 cut(s) 66, 297
XceI RCATGY 3 cut(s) 218, 256, 271
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.