Rh7BG319200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
30960886 .. 30963030
2145 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG319200.1

Sequence Viewer

Length: 219 bp
ATGAACATGACCAATCCCCTTCCGGTAGGCAACTGTGGAACCCCCATGCAGGATGAACCGCCCGAGGTTCCTCCGGCTCATTTGAACTCACCGACTAGTGCGGTGGAAGTCCATGTTCATCCTCCGTTTCCTCTTCATGCAGACGATCCGACCAATCCATTTCATAACCGCAATGTCGATGAAGAACTGGGTCTAGTGGATAACTTTGCCATGATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

7.86

Weight (kDa)

4.43

Isoelectric Point (pI)

39.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 59, 101, 169
AclWI GGATC 1 cut(s) 140
AfiI CCNNNNNNNGG 1 cut(s) 49
AgsI TTSAA 1 cut(s) 85
AhlI ACTAGT 1 cut(s) 95
AlwI GGATC 1 cut(s) 140
Ama87I CYCGRG 1 cut(s) 62
AsuHPI GGTGA 1 cut(s) 81
AvaI CYCGRG 1 cut(s) 62
BcuI ACTAGT 1 cut(s) 95
BfaI CTAG 2 cut(s) 96, 194
BmeT110I CYCGRG 1 cut(s) 62
BmiI GGNNCC 2 cut(s) 40, 69
BmrI ACTGGG 1 cut(s) 197
BmuI ACTGGG 1 cut(s) 197
BsaJI CCNNGG 1 cut(s) 63
BsaWI WCCGGW 1 cut(s) 22
Bsc4I CCNNNNNNNGG 1 cut(s) 49
Bse1I ACTGG 1 cut(s) 192
Bse3DI GCAATG 1 cut(s) 178
BseDI CCNNGG 1 cut(s) 63
BseGI GGATG 2 cut(s) 58, 118
BseLI CCNNNNNNNGG 1 cut(s) 49
BseMI GCAATG 1 cut(s) 178
BseNI ACTGG 1 cut(s) 192
BsiHKCI CYCGRG 1 cut(s) 62
BsiSI CCGG 2 cut(s) 23, 74
BslI CCNNNNNNNGG 1 cut(s) 49
BsoBI CYCGRG 1 cut(s) 62
Bsp143I GATC 1 cut(s) 145
BspACI CCGC 3 cut(s) 59, 101, 169
BspLI GGNNCC 2 cut(s) 40, 69
BspPI GGATC 1 cut(s) 140
BsrDI GCAATG 1 cut(s) 178
BsrI ACTGG 1 cut(s) 192
BssECI CCNNGG 1 cut(s) 63
BssMI GATC 1 cut(s) 145
Bst4CI ACNGT 1 cut(s) 35
Bst6I CTCTTC 1 cut(s) 138
BstF5I GGATG 2 cut(s) 58, 118
BstKTI GATC 1 cut(s) 148
BstMBI GATC 1 cut(s) 145
BtsCI GGATG 2 cut(s) 58, 118
CviAII CATG 5 cut(s) 7, 46, 113, 137, 211
CviJI RGCY 1 cut(s) 77
CviKI_1 RGCY 1 cut(s) 77
DpnI GATC 1 cut(s) 147
DpnII GATC 1 cut(s) 145
Eam1104I CTCTTC 1 cut(s) 138
EarI CTCTTC 1 cut(s) 138
Eco88I CYCGRG 1 cut(s) 62
FaeI CATG 5 cut(s) 10, 49, 116, 140, 214
FaiI YATR 7 cut(s) 8, 47, 114, 138, 165, 212, 217
FatI CATG 5 cut(s) 6, 45, 112, 136, 210
FokI GGATG 2 cut(s) 65, 105
FspBI CTAG 2 cut(s) 96, 194
HapII CCGG 2 cut(s) 23, 74
Hin1II CATG 5 cut(s) 10, 49, 116, 140, 214
HpaII CCGG 2 cut(s) 23, 74
HphI GGTGA 1 cut(s) 81
Hpy188I TCNGA 1 cut(s) 150
HpyAV CCTTC 1 cut(s) 29
HpyCH4III ACNGT 1 cut(s) 35
HpyCH4V TGCA 2 cut(s) 49, 140
Hsp92II CATG 5 cut(s) 10, 49, 116, 140, 214
Kzo9I GATC 1 cut(s) 145
LpnPI CCDG 4 cut(s) 35, 36, 87, 173
MaeI CTAG 2 cut(s) 96, 194
MalI GATC 1 cut(s) 147
MboI GATC 1 cut(s) 145
MboII GAAGA 2 cut(s) 125, 194
MmeI TCCRAC 1 cut(s) 173
MnlI CCTC 4 cut(s) 58, 81, 132, 141
MspI CCGG 2 cut(s) 23, 74
NdeII GATC 1 cut(s) 145
NlaIII CATG 5 cut(s) 10, 49, 116, 140, 214
NlaIV GGNNCC 2 cut(s) 40, 69
PspN4I GGNNCC 2 cut(s) 40, 69
Sau3AI GATC 1 cut(s) 145
SetI ASST 1 cut(s) 69
SpeI ACTAGT 1 cut(s) 95
SsiI CCGC 3 cut(s) 59, 101, 169
SspMI CTAG 2 cut(s) 96, 194
TaaI ACNGT 1 cut(s) 35
TaqI TCGA 1 cut(s) 177
TspDTI ATGAA 6 cut(s) 17, 69, 107, 125, 152, 195
TspGWI ACGGA 1 cut(s) 114
XspI CTAG 2 cut(s) 96, 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.