Rh1AG084400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
14450338 .. 14454181
3844 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG084400.1

Sequence Viewer

Length: 216 bp
ATGATCGTAGACATTGGGTTACAAGCGAAACCAAGGAAGCCTGATGGCCCTAGCTACTTGCCAGTTGCCACACAGGAGCAGAGACTCGCTATTACACCTCGGGAAGAGGCAGATGAGCTATGTCTAACACTAGAGGAGAATGAGGATAAGTCAAGTACTGCCTCAGAGATCGATGGGAGATGTGCTTTATTATTCCATAGTTCTGCTGGCCCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

7.71

Weight (kDa)

4.52

Isoelectric Point (pI)

41.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 9
AfaI GTAC 1 cut(s) 157
AluBI AGCT 2 cut(s) 54, 118
AluI AGCT 2 cut(s) 54, 118
Alw26I GTCTC 1 cut(s) 76
Ama87I CYCGRG 1 cut(s) 99
AoxI GGCC 2 cut(s) 46, 208
AspS9I GGNCC 2 cut(s) 47, 209
AvaI CYCGRG 1 cut(s) 99
BccI CCATC 2 cut(s) 38, 167
BcoDI GTCTC 1 cut(s) 76
BfaI CTAG 2 cut(s) 51, 131
BmcAI AGTACT 1 cut(s) 157
BmeT110I CYCGRG 1 cut(s) 99
BmgT120I GGNCC 2 cut(s) 47, 209
Bsa29I ATCGAT 1 cut(s) 171
BsaJI CCNNGG 2 cut(s) 32, 98
Bse1I ACTGG 1 cut(s) 62
BseCI ATCGAT 1 cut(s) 171
BseDI CCNNGG 2 cut(s) 32, 98
BseMII CTCAG 1 cut(s) 177
BseNI ACTGG 1 cut(s) 62
BseRI GAGGAG 1 cut(s) 149
BshFI GGCC 2 cut(s) 48, 210
BshVI ATCGAT 1 cut(s) 171
BsiHKCI CYCGRG 1 cut(s) 99
BsmAI GTCTC 1 cut(s) 76
BsnI GGCC 2 cut(s) 48, 210
BsoBI CYCGRG 1 cut(s) 99
Bsp143I GATC 2 cut(s) 3, 168
BspANI GGCC 2 cut(s) 48, 210
BspCNI CTCAG 1 cut(s) 176
BspDI ATCGAT 1 cut(s) 171
BsrI ACTGG 1 cut(s) 62
BssECI CCNNGG 2 cut(s) 32, 98
BssMI GATC 2 cut(s) 3, 168
BssT1I CCWWGG 1 cut(s) 32
Bst6I CTCTTC 1 cut(s) 99
BstC8I GCNNGC 1 cut(s) 208
BstDEI CTNAG 2 cut(s) 163, 213
BstKTI GATC 2 cut(s) 6, 171
BstMAI GTCTC 1 cut(s) 76
BstMBI GATC 2 cut(s) 3, 168
Bsu15I ATCGAT 1 cut(s) 171
BsuRI GGCC 2 cut(s) 48, 210
BsuTUI ATCGAT 1 cut(s) 171
Cac8I GCNNGC 1 cut(s) 208
Cfr13I GGNCC 2 cut(s) 47, 209
ClaI ATCGAT 1 cut(s) 171
Csp6I GTAC 1 cut(s) 156
CviJI RGCY 5 cut(s) 40, 48, 54, 118, 210
CviKI_1 RGCY 5 cut(s) 40, 48, 54, 118, 210
CviQI GTAC 1 cut(s) 156
DdeI CTNAG 2 cut(s) 163, 213
DpnI GATC 2 cut(s) 5, 170
DpnII GATC 2 cut(s) 3, 168
Eam1104I CTCTTC 1 cut(s) 99
EarI CTCTTC 1 cut(s) 99
Eco130I CCWWGG 1 cut(s) 32
Eco88I CYCGRG 1 cut(s) 99
EcoT14I CCWWGG 1 cut(s) 32
ErhI CCWWGG 1 cut(s) 32
FaiI YATR 2 cut(s) 121, 198
FblI GTMKAC 1 cut(s) 9
FspBI CTAG 2 cut(s) 51, 131
HaeIII GGCC 2 cut(s) 48, 210
HinfI GANTC 1 cut(s) 84
Hpy166II GTNNAC 1 cut(s) 10
Hpy188I TCNGA 1 cut(s) 166
Hpy188III TCNNGA 1 cut(s) 101
Hpy8I GTNNAC 1 cut(s) 10
HpyF3I CTNAG 2 cut(s) 163, 213
Kzo9I GATC 2 cut(s) 3, 168
LmnI GCTCC 1 cut(s) 76
LpnPI CCDG 4 cut(s) 54, 59, 75, 192
MaeI CTAG 2 cut(s) 51, 131
MaeIII GTNAC 1 cut(s) 18
MalI GATC 2 cut(s) 5, 170
MboI GATC 2 cut(s) 3, 168
MboII GAAGA 1 cut(s) 116
MlyI GAGTC 1 cut(s) 78
MnlI CCTC 5 cut(s) 100, 108, 127, 136, 172
NdeII GATC 2 cut(s) 3, 168
PleI GAGTC 1 cut(s) 78
PpsI GAGTC 1 cut(s) 78
PspPI GGNCC 2 cut(s) 47, 209
RsaI GTAC 1 cut(s) 157
RsaNI GTAC 1 cut(s) 156
Sau3AI GATC 2 cut(s) 3, 168
Sau96I GGNCC 2 cut(s) 47, 209
ScaI AGTACT 1 cut(s) 157
SchI GAGTC 1 cut(s) 78
SetI ASST 3 cut(s) 56, 100, 120
SspMI CTAG 2 cut(s) 51, 131
StyI CCWWGG 1 cut(s) 32
TaqI TCGA 1 cut(s) 171
TatI WGTACW 1 cut(s) 155
XcmI CCANNNNNNNNNTGG 1 cut(s) 203
XmiI GTMKAC 1 cut(s) 9
XspI CTAG 2 cut(s) 51, 131
ZrmI AGTACT 1 cut(s) 157
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.