Rh2AG297100

Histidine biosynthesis bifunctional protein hisIE

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Reverse (-)
36843409 .. 36845472
2064 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG297100.1

Sequence Viewer

Length: 231 bp
ATGATTATATACCTAGGGAAGCCTGATGGCCCTAGCTACTTGCCAGTTTCCACACAGGAGCAGAGACTTGCTATTACACCTTGGGAAGAGGCAGATGAGCTATGTCTAACACTAGAGGAGAATGAGGATAAGTCAAGTACTGCCTCCGAGATGGGAGGTGTGCTTTATTATTCCATGGTTCTGCTGGCCCTTAGAGATGGAAAAATGGAAGATGTTCTAGAAATTCTGTGA

Protein Analysis

76

Amino Acids

8.51

Weight (kDa)

4.05

Isoelectric Point (pI)

51.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 222
AfaI GTAC 1 cut(s) 139
AluBI AGCT 2 cut(s) 36, 100
AluI AGCT 2 cut(s) 36, 100
Alw26I GTCTC 1 cut(s) 58
AoxI GGCC 2 cut(s) 28, 186
ApoI RAATTY 1 cut(s) 222
Asp700I GAANNNNTTC 1 cut(s) 213
AspA2I CCTAGG 1 cut(s) 13
AspS9I GGNCC 2 cut(s) 29, 187
AvrII CCTAGG 1 cut(s) 13
BccI CCATC 3 cut(s) 20, 145, 191
BcoDI GTCTC 1 cut(s) 58
BfaI CTAG 4 cut(s) 14, 33, 113, 218
BlnI CCTAGG 1 cut(s) 13
BmcAI AGTACT 1 cut(s) 139
BmgT120I GGNCC 2 cut(s) 29, 187
BsaJI CCNNGG 3 cut(s) 13, 80, 174
Bse1I ACTGG 1 cut(s) 44
BseDI CCNNGG 3 cut(s) 13, 80, 174
BseNI ACTGG 1 cut(s) 44
BseRI GAGGAG 1 cut(s) 131
BshFI GGCC 2 cut(s) 30, 188
BsmAI GTCTC 1 cut(s) 58
BsnI GGCC 2 cut(s) 30, 188
Bsp19I CCATGG 1 cut(s) 174
BspANI GGCC 2 cut(s) 30, 188
BsrI ACTGG 1 cut(s) 44
BssECI CCNNGG 3 cut(s) 13, 80, 174
BssT1I CCWWGG 3 cut(s) 13, 80, 174
Bst6I CTCTTC 1 cut(s) 81
BstC8I GCNNGC 1 cut(s) 186
BstDEI CTNAG 1 cut(s) 191
BstDSI CCRYGG 1 cut(s) 174
BstMAI GTCTC 1 cut(s) 58
BsuRI GGCC 2 cut(s) 30, 188
BtgI CCRYGG 1 cut(s) 174
Cac8I GCNNGC 1 cut(s) 186
Cfr13I GGNCC 2 cut(s) 29, 187
Csp6I GTAC 1 cut(s) 138
CviAII CATG 1 cut(s) 175
CviJI RGCY 5 cut(s) 22, 30, 36, 100, 188
CviKI_1 RGCY 5 cut(s) 22, 30, 36, 100, 188
CviQI GTAC 1 cut(s) 138
DdeI CTNAG 1 cut(s) 191
Eam1104I CTCTTC 1 cut(s) 81
EarI CTCTTC 1 cut(s) 81
Eco130I CCWWGG 3 cut(s) 13, 80, 174
EcoT14I CCWWGG 3 cut(s) 13, 80, 174
ErhI CCWWGG 3 cut(s) 13, 80, 174
FaeI CATG 1 cut(s) 178
FaiI YATR 4 cut(s) 8, 10, 103, 176
FatI CATG 1 cut(s) 174
FspBI CTAG 4 cut(s) 14, 33, 113, 218
HaeIII GGCC 2 cut(s) 30, 188
Hin1II CATG 1 cut(s) 178
Hpy188I TCNGA 1 cut(s) 148
Hpy188III TCNNGA 1 cut(s) 218
HpyF3I CTNAG 1 cut(s) 191
Hsp92II CATG 1 cut(s) 178
LmnI GCTCC 1 cut(s) 58
LpnPI CCDG 4 cut(s) 36, 41, 57, 170
MaeI CTAG 4 cut(s) 14, 33, 113, 218
MboII GAAGA 2 cut(s) 98, 221
MluCI AATT 1 cut(s) 222
MnlI CCTC 5 cut(s) 82, 109, 118, 149, 154
MroXI GAANNNNTTC 1 cut(s) 213
NcoI CCATGG 1 cut(s) 174
NlaIII CATG 1 cut(s) 178
PdmI GAANNNNTTC 1 cut(s) 213
PspPI GGNCC 2 cut(s) 29, 187
RsaI GTAC 1 cut(s) 139
RsaNI GTAC 1 cut(s) 138
Sau96I GGNCC 2 cut(s) 29, 187
ScaI AGTACT 1 cut(s) 139
SetI ASST 5 cut(s) 15, 38, 82, 102, 160
Sse9I AATT 1 cut(s) 222
SspMI CTAG 4 cut(s) 14, 33, 113, 218
StyI CCWWGG 3 cut(s) 13, 80, 174
TasI AATT 1 cut(s) 222
TatI WGTACW 1 cut(s) 137
XapI RAATTY 1 cut(s) 222
XbaI TCTAGA 1 cut(s) 217
XcmI CCANNNNNNNNNTGG 1 cut(s) 181
XmaJI CCTAGG 1 cut(s) 13
XmnI GAANNNNTTC 1 cut(s) 213
XspI CTAG 4 cut(s) 14, 33, 113, 218
ZrmI AGTACT 1 cut(s) 139
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.