Rh2AG171200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0000606
Physical Location & Seq
Reverse (-)
16274265 .. 16275467
1203 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG171200.1

Sequence Viewer

Length: 252 bp
ATGGCTCCATCAATACTTATCCCTAACTCAATTTACGATTCATACAGAAAGAGGAGCAGAGCAAAATCAAACAGGAGGAGAAAATTATTATCAAGTCGGCTGGCAATTTTGCAGATTCACTTGAGCGACGACGATACTGGCATTGATGCAAGAAGTGGCGCACTTCTTCAGAACAAAGATTGGAATATTGTCTCAAGAATACAAACTTGGCAAAGAGAACAGATGCAGAATATGAAGTTGCTGATTCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

9.71

Weight (kDa)

10.91

Isoelectric Point (pI)

73.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000606)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g08780 FvH4_1g08790 FvH4_1g08830 FvH4_6g25820
malus_domestica MD02G1092100.v1.1 MD02G1092500.v1.1 MD02G1093200.v1.1 MD15G1218600.v1.1
prunus_persica Prupe.7G197500_v2.0.a1 Prupe.7G197700_v2.0.a1 Prupe.7G197900_v2.0.a1 Prupe.7G198000_v2.0.a1 Prupe.7G198100_v2.0.a1 Prupe.7G198300_v2.0.a1
pyrus_communis pycom02g07340 pycom15g19370
rosa_chinensis RchiOBHm_Chr2g0094941 RchiOBHm_Chr2g0094971 RchiOBHm_Chr2g0095051 RchiOBHm_Chr2g0095221 RchiOBHm_Chr2g0095231 RchiOBHm_Chr2g0095261 RchiOBHm_Chr2g0103351 RchiOBHm_Chr2g0104551 RchiOBHm_Chr6g0297411
rosa_laevigata RLG00000016533 RLG00000016545 RLG00000016547 RLG00000016548 RLG00000017226
rosa_multiflora Rmu_sc0001555.1_g000008 Rmu_sc0003274.1_g000003 Rmu_sc0004316.1_g000013 Rmu_ssc0000183.1_g000015 Rmu_ssc0000183.1_g000017 Rmu_ssc0000183.1_g000023
rosa_roxburghii Rroxscaffold_2G00116650 Rroxscaffold_2G00139710 Rroxscaffold_2G00146510 Rroxscaffold_2G00146530 Rroxscaffold_2G00146690 Rroxscaffold_2G00146750 Rroxscaffold_3G00256890 Rroxscaffold_4G00297070 Rroxscaffold_4G00303160 Rroxscaffold_5G00374070 Rroxscaffold_6G00419510 Rroxscaffold_7G00186670 Rroxscaffold_7G00198970
rosa_rugosa Rorug01G0110700 Rorug02G0048900 Rorug02G0048900 Rorug02G0114200
rosa_samantha Rh1BG006000 Rh2AG162400 Rh2AG171200 Rh2BG096800 Rh2BG098400 Rh2CG098700 Rh2CG098900 Rh2CG100200 Rh2CG100400 Rh2CG169600 Rh2DG095400 Rh2DG095500 Rh2DG095600 Rh2DG098000 Rh2DG098100 Rh2DG168400 Rh4DG392900 Rh5DG019100 Rh5DG019200 Rh5DG460500 Rh6AG073600 Rh7DG484100
rosa_wichuraiana Rw2G007210 Rw2G007290 Rw2G007310 Rw2G007330 Rw2G012760

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 152
AjuI GAANNNNNNNTTGG 2 cut(s) 190, 222
Alw26I GTCTC 1 cut(s) 196
AspLEI GCGC 1 cut(s) 161
BccI CCATC 1 cut(s) 16
BcoDI GTCTC 1 cut(s) 196
BmiI GGNNCC 1 cut(s) 6
BmsI GCATC 2 cut(s) 136, 213
BpuEI CTTGAG 2 cut(s) 142, 178
Bse1I ACTGG 1 cut(s) 142
BseNI ACTGG 1 cut(s) 142
BseRI GAGGAG 2 cut(s) 67, 91
BsmAI GTCTC 1 cut(s) 196
BspLI GGNNCC 1 cut(s) 6
BsrI ACTGG 1 cut(s) 142
BstC8I GCNNGC 1 cut(s) 102
BstHHI GCGC 1 cut(s) 161
BstMAI GTCTC 1 cut(s) 196
Cac8I GCNNGC 1 cut(s) 102
CfoI GCGC 1 cut(s) 161
CviJI RGCY 2 cut(s) 5, 100
CviKI_1 RGCY 2 cut(s) 5, 100
Eco57I CTGAAG 1 cut(s) 152
FaiI YATR 2 cut(s) 43, 233
GlaI GCGC 1 cut(s) 160
HhaI GCGC 1 cut(s) 161
Hin6I GCGC 1 cut(s) 159
HinP1I GCGC 1 cut(s) 159
HinfI GANTC 3 cut(s) 38, 115, 244
Hpy188I TCNGA 1 cut(s) 171
Hpy188III TCNNGA 1 cut(s) 195
Hpy99I CGWCG 2 cut(s) 131, 134
HpyCH4V TGCA 3 cut(s) 112, 149, 226
HspAI GCGC 1 cut(s) 159
LmnI GCTCC 2 cut(s) 10, 54
LpnPI CCDG 3 cut(s) 58, 86, 123
LweI GCATC 2 cut(s) 136, 213
MboII GAAGA 1 cut(s) 158
MluCI AATT 3 cut(s) 30, 83, 105
MnlI CCTC 2 cut(s) 45, 69
NlaIV GGNNCC 1 cut(s) 6
PfeI GAWTC 3 cut(s) 38, 115, 244
PspN4I GGNNCC 1 cut(s) 6
SfaNI GCATC 2 cut(s) 136, 213
SgeI CNNG 8 cut(s) 85, 105, 113, 133, 150, 162, 207, 219
SmlI CTYRAG 2 cut(s) 121, 193
SmoI CTYRAG 2 cut(s) 121, 193
Sse9I AATT 3 cut(s) 30, 83, 105
SspI AATATT 1 cut(s) 187
TasI AATT 3 cut(s) 30, 83, 105
TfiI GAWTC 3 cut(s) 38, 115, 244
TspDTI ATGAA 2 cut(s) 30, 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.