Rh3CG127800
ERF Family

Belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
10415892 .. 10416199
308 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG127800.1

Sequence Viewer

Length: 216 bp
ATGCTTTCCAAAGAGGTACAGCTAAATGAGAAGCTACTAGTAGAACCAAGGCCAAGGAGGTATGCACCTCATCATGGAGGTGGTGCCAGTGGGGAGGGAACATCATCTTCTCAGTCAGATAAAGATAAACGCGGGAAATCATTGGCAAATCCTGATGTAACTTCCACCCAGTCGTATATATATGAATCTCAAACGCAAATGTTTCCCAGGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

7.88

Weight (kDa)

9.16

Isoelectric Point (pI)

46.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 83
AccII CGCG 1 cut(s) 132
AciI CCGC 1 cut(s) 132
AfaI GTAC 1 cut(s) 18
AfiI CCNNNNNNNGG 1 cut(s) 74
AhlI ACTAGT 1 cut(s) 37
AjnI CCWGG 1 cut(s) 206
AluBI AGCT 2 cut(s) 22, 34
AluI AGCT 2 cut(s) 22, 34
AoxI GGCC 1 cut(s) 50
BanI GGYRCC 1 cut(s) 83
BciT130I CCWGG 1 cut(s) 208
BcuI ACTAGT 1 cut(s) 37
BfaI CTAG 2 cut(s) 38, 214
Bme1390I CCNGG 1 cut(s) 208
BmiI GGNNCC 1 cut(s) 85
BmrFI CCNGG 1 cut(s) 208
BmrI ACTGGG 1 cut(s) 163
BmuI ACTGGG 1 cut(s) 163
BsaJI CCNNGG 3 cut(s) 47, 53, 206
Bsc4I CCNNNNNNNGG 1 cut(s) 74
Bse1I ACTGG 2 cut(s) 87, 169
BseBI CCWGG 1 cut(s) 208
BseDI CCNNGG 3 cut(s) 47, 53, 206
BseLI CCNNNNNNNGG 1 cut(s) 74
BseMII CTCAG 1 cut(s) 125
BseNI ACTGG 2 cut(s) 87, 169
Bsh1236I CGCG 1 cut(s) 132
BshFI GGCC 1 cut(s) 52
BshNI GGYRCC 1 cut(s) 83
BslI CCNNNNNNNGG 1 cut(s) 74
BsnI GGCC 1 cut(s) 52
BspACI CCGC 1 cut(s) 132
BspANI GGCC 1 cut(s) 52
BspCNI CTCAG 1 cut(s) 124
BspFNI CGCG 1 cut(s) 132
BspLI GGNNCC 1 cut(s) 85
BspT107I GGYRCC 1 cut(s) 83
BsrI ACTGG 2 cut(s) 87, 169
BssECI CCNNGG 3 cut(s) 47, 53, 206
BssT1I CCWWGG 2 cut(s) 47, 53
Bst2UI CCWGG 1 cut(s) 208
BstDEI CTNAG 1 cut(s) 111
BstFNI CGCG 1 cut(s) 132
BstNI CCWGG 1 cut(s) 208
BstSCI CCNGG 1 cut(s) 206
BstUI CGCG 1 cut(s) 132
BsuRI GGCC 1 cut(s) 52
BtsIMutI CAGTG 1 cut(s) 94
Csp6I GTAC 1 cut(s) 17
CviAII CATG 1 cut(s) 74
CviJI RGCY 3 cut(s) 22, 34, 52
CviKI_1 RGCY 3 cut(s) 22, 34, 52
CviQI GTAC 1 cut(s) 17
DdeI CTNAG 1 cut(s) 111
Eco130I CCWWGG 2 cut(s) 47, 53
EcoRII CCWGG 1 cut(s) 206
EcoT14I CCWWGG 2 cut(s) 47, 53
ErhI CCWWGG 2 cut(s) 47, 53
FaeI CATG 1 cut(s) 77
FaiI YATR 6 cut(s) 63, 75, 177, 179, 181, 183
FatI CATG 1 cut(s) 73
FauI CCCGC 1 cut(s) 125
FspBI CTAG 2 cut(s) 38, 214
HaeIII GGCC 1 cut(s) 52
Hin1II CATG 1 cut(s) 77
HinfI GANTC 1 cut(s) 185
Hpy188I TCNGA 1 cut(s) 118
Hpy188III TCNNGA 1 cut(s) 152
HpyCH4V TGCA 1 cut(s) 65
HpyF3I CTNAG 1 cut(s) 111
Hsp92II CATG 1 cut(s) 77
LpnPI CCDG 4 cut(s) 100, 165, 182, 193
MaeI CTAG 2 cut(s) 38, 214
MaeIII GTNAC 1 cut(s) 157
MboII GAAGA 1 cut(s) 99
MnlI CCTC 5 cut(s) 7, 51, 71, 78, 88
MslI CAYNNNNRTG 1 cut(s) 78
MspR9I CCNGG 1 cut(s) 208
MvaI CCWGG 1 cut(s) 208
MvnI CGCG 1 cut(s) 132
NlaIII CATG 1 cut(s) 77
NlaIV GGNNCC 1 cut(s) 85
PfeI GAWTC 1 cut(s) 185
Psp6I CCWGG 1 cut(s) 206
PspGI CCWGG 1 cut(s) 206
PspN4I GGNNCC 1 cut(s) 85
RsaI GTAC 1 cut(s) 18
RsaNI GTAC 1 cut(s) 17
RseI CAYNNNNRTG 1 cut(s) 78
ScrFI CCNGG 1 cut(s) 208
SetI ASST 6 cut(s) 18, 24, 36, 62, 70, 82
SgeI CNNG 9 cut(s) 50, 60, 66, 86, 99, 143, 145, 164, 181
SmiMI CAYNNNNRTG 1 cut(s) 78
SpeI ACTAGT 1 cut(s) 37
SsiI CCGC 1 cut(s) 132
SspMI CTAG 2 cut(s) 38, 214
StyD4I CCNGG 1 cut(s) 206
StyI CCWWGG 2 cut(s) 47, 53
TfiI GAWTC 1 cut(s) 185
TscAI CASTG 1 cut(s) 94
TspDTI ATGAA 1 cut(s) 198
TspRI CASTG 1 cut(s) 94
XspI CTAG 2 cut(s) 38, 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.