Rh4AG024200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
4723462 .. 4724061
600 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG024200.1

Sequence Viewer

Length: 264 bp
ATGCCCTTCATACATCCTGGATTTCCAACAACTTTTGGTGCTCAAGGCATTCCCTCGCATTATCCTTATGGATTTCCACCAACAACTTCTAGTGTACAAGCAATGCCTAATCAATCACATGACATTCCCTCGCATTTTCCTTATGGATTTCCACCAACAGCTTTTATTGTTCATGCAATTCCAAGTCAATCACTTGGTTACCAACCTATTCGTCCAATGTTTGATTATTCACTTATGTATTCACAGATTTGTTTATCTAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

9.67

Weight (kDa)

6.95

Isoelectric Point (pI)

68.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 96
AjnI CCWGG 1 cut(s) 16
AluBI AGCT 1 cut(s) 161
AluI AGCT 1 cut(s) 161
Alw21I GWGCWC 1 cut(s) 43
Bbv12I GWGCWC 1 cut(s) 43
BciT130I CCWGG 1 cut(s) 18
BfaI CTAG 1 cut(s) 90
Bme1390I CCNGG 1 cut(s) 18
BmrFI CCNGG 1 cut(s) 18
BpuEI CTTGAG 1 cut(s) 27
Bse3DI GCAATG 1 cut(s) 108
BseBI CCWGG 1 cut(s) 18
BseGI GGATG 1 cut(s) 13
BseMI GCAATG 1 cut(s) 108
BsiHKAI GWGCWC 1 cut(s) 43
BsmI GAATGC 1 cut(s) 48
Bsp1286I GDGCHC 1 cut(s) 43
Bsp1407I TGTACA 1 cut(s) 94
BsrDI GCAATG 1 cut(s) 108
BsrGI TGTACA 1 cut(s) 94
Bst2UI CCWGG 1 cut(s) 18
BstAUI TGTACA 1 cut(s) 94
BstEII GGTNACC 1 cut(s) 197
BstF5I GGATG 1 cut(s) 13
BstNI CCWGG 1 cut(s) 18
BstPI GGTNACC 1 cut(s) 197
BstSCI CCNGG 1 cut(s) 16
BtsCI GGATG 1 cut(s) 13
Csp6I GTAC 1 cut(s) 95
CviAII CATG 2 cut(s) 119, 173
CviJI RGCY 1 cut(s) 161
CviKI_1 RGCY 1 cut(s) 161
CviQI GTAC 1 cut(s) 95
Eco91I GGTNACC 1 cut(s) 197
EcoO65I GGTNACC 1 cut(s) 197
EcoRII CCWGG 1 cut(s) 16
FaeI CATG 2 cut(s) 122, 176
FaiI YATR 6 cut(s) 11, 69, 120, 144, 174, 236
FatI CATG 2 cut(s) 118, 172
FspBI CTAG 1 cut(s) 90
Hin1II CATG 2 cut(s) 122, 176
Hpy166II GTNNAC 1 cut(s) 95
Hpy8I GTNNAC 1 cut(s) 95
HpyAV CCTTC 1 cut(s) 16
HpyCH4V TGCA 1 cut(s) 176
Hsp92II CATG 2 cut(s) 122, 176
LpnPI CCDG 2 cut(s) 3, 30
MaeI CTAG 1 cut(s) 90
MaeIII GTNAC 1 cut(s) 197
MhlI GDGCHC 1 cut(s) 43
MluCI AATT 1 cut(s) 177
MmeI TCCRAC 1 cut(s) 50
MnlI CCTC 2 cut(s) 64, 139
MspR9I CCNGG 1 cut(s) 18
Mva1269I GAATGC 1 cut(s) 48
MvaI CCWGG 1 cut(s) 18
NlaIII CATG 2 cut(s) 122, 176
PctI GAATGC 1 cut(s) 48
PfoI TCCNGGA 1 cut(s) 16
Psp6I CCWGG 1 cut(s) 16
PspEI GGTNACC 1 cut(s) 197
PspGI CCWGG 1 cut(s) 16
RsaI GTAC 1 cut(s) 96
RsaNI GTAC 1 cut(s) 95
ScrFI CCNGG 1 cut(s) 18
SduI GDGCHC 1 cut(s) 43
SetI ASST 2 cut(s) 163, 208
SmlI CTYRAG 1 cut(s) 42
SmoI CTYRAG 1 cut(s) 42
Sse9I AATT 1 cut(s) 177
SspMI CTAG 1 cut(s) 90
StyD4I CCNGG 1 cut(s) 16
TasI AATT 1 cut(s) 177
TatI WGTACW 1 cut(s) 94
TspDTI ATGAA 1 cut(s) 161
XspI CTAG 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.