Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr5A

Orthogroup ID

OG0002145

Physical Location & Seq

Genomic Coordinates Forward (+)

41004572 .. 41021242

Gene Structure 16671 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh5AG295100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 255 bp

ATGGATTTCCACCAATTAACAGCTTCTATTGTTCATGCAATTCCAAGTCAATCACTTGGTTACCAACCTATTCGTCCACTATTTGATTATTCACTTATGTATTCACAGAGACGAAAGCAGAAATTTGGTTGGTTGAGAGTTGAGACTAAAAAGTTTGTTTCTCAAAAGCATACTCCAAATAATGATAATCAAATGCGTCTAGAAATGAATGATTGCCTAAAAGCGCAAAGGCCCCATACAGAGGCCCGTACATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

84

Amino Acids

9.99

Weight (kDa)

9.91

Isoelectric Point (pI)

47.04

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002145)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g08310 FvH4_1g08310 FvH4_1g08310 FvH4_1g08310 FvH4_2g12170 FvH4_2g12180 FvH4_2g19451 FvH4_3g23921 FvH4_4g25611 FvH4_5g29941 FvH4_6g17541 FvH4_6g46760 FvH4_6g46760 FvH4_6g46760 FvH4_6g46760 FvH4_6g46760
prunus_persica	Prupe.1G194600_v2.0.a1 Prupe.4G265400_v2.0.a1 Prupe.I001300_v2.0.a1
pyrus_communis	pycom11g10270 pycom17g27220
rosa_chinensis	RchiOBHm_Chr1g0369391
rosa_laevigata	RLG00000016628 RLG00000017077
rosa_multiflora	Rmu_sc0004459.1_g000001 Rmu_sc0008921.1_g000017 Rmu_sc0009600.1_g000001
rosa_roxburghii	Rroxscaffold_1G00023120 Rroxscaffold_1G00042200 Rroxscaffold_7G00200270
rosa_rugosa	Rorug06G0105800.1 Rorug06G0247300 Rorug07G0023300
rosa_samantha	Rh1AG232800 Rh1CG217500 Rh2BG480600 Rh2DG489500 Rh4AG024200 Rh5AG295100 Rh5AG295300 Rh5AG338800 Rh5CG298700 Rh7BG152500
rosa_wichuraiana	Rw5G032010

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	122
AfaI	GTAC	1 cut(s)	250
AfiI	CCNNNNNNNGG	1 cut(s)	241
AluBI	AGCT	1 cut(s)	23
AluI	AGCT	1 cut(s)	23
Alw26I	GTCTC	2 cut(s)	103, 137
AoxI	GGCC	2 cut(s)	230, 243
ApoI	RAATTY	1 cut(s)	122
AspLEI	GCGC	1 cut(s)	226
AspS9I	GGNCC	2 cut(s)	231, 244
BcoDI	GTCTC	2 cut(s)	103, 137
BfaI	CTAG	1 cut(s)	200
BmgT120I	GGNCC	2 cut(s)	231, 244
BmiI	GGNNCC	1 cut(s)	233
Bsc4I	CCNNNNNNNGG	1 cut(s)	241
BseLI	CCNNNNNNNGG	1 cut(s)	241
BshFI	GGCC	2 cut(s)	232, 245
BslI	CCNNNNNNNGG	1 cut(s)	241
BsmAI	GTCTC	2 cut(s)	103, 137
BsmBI	CGTCTC	1 cut(s)	103
BsnI	GGCC	2 cut(s)	232, 245
BspANI	GGCC	2 cut(s)	232, 245
BspLI	GGNNCC	1 cut(s)	233
BstEII	GGTNACC	1 cut(s)	59
BstHHI	GCGC	1 cut(s)	226
BstMAI	GTCTC	2 cut(s)	103, 137
BstPI	GGTNACC	1 cut(s)	59
BsuRI	GGCC	2 cut(s)	232, 245
CfoI	GCGC	1 cut(s)	226
Cfr13I	GGNCC	2 cut(s)	231, 244
CseI	GACGC	1 cut(s)	185
Csp6I	GTAC	1 cut(s)	249
CviAII	CATG	1 cut(s)	35
CviJI	RGCY	3 cut(s)	23, 232, 245
CviKI_1	RGCY	3 cut(s)	23, 232, 245
CviQI	GTAC	1 cut(s)	249
Eco91I	GGTNACC	1 cut(s)	59
EcoO109I	RGGNCCY	1 cut(s)	231
EcoO65I	GGTNACC	1 cut(s)	59
Esp3I	CGTCTC	1 cut(s)	103
FaeI	CATG	1 cut(s)	38
FaiI	YATR	5 cut(s)	36, 98, 171, 237, 253
FatI	CATG	1 cut(s)	34
FspBI	CTAG	1 cut(s)	200
GlaI	GCGC	1 cut(s)	225
HaeIII	GGCC	2 cut(s)	232, 245
HgaI	GACGC	1 cut(s)	185
HhaI	GCGC	1 cut(s)	226
Hin1II	CATG	1 cut(s)	38
Hin6I	GCGC	1 cut(s)	224
HinP1I	GCGC	1 cut(s)	224
Hpy166II	GTNNAC	1 cut(s)	77
Hpy188III	TCNNGA	1 cut(s)	200
Hpy8I	GTNNAC	1 cut(s)	77
HpyCH4V	TGCA	1 cut(s)	38
Hsp92II	CATG	1 cut(s)	38
HspAI	GCGC	1 cut(s)	224
MaeI	CTAG	1 cut(s)	200
MaeIII	GTNAC	1 cut(s)	59
MluCI	AATT	3 cut(s)	14, 39, 122
MnlI	CCTC	1 cut(s)	235
MseI	TTAA	1 cut(s)	17
NlaIII	CATG	1 cut(s)	38
NlaIV	GGNNCC	1 cut(s)	233
PspEI	GGTNACC	1 cut(s)	59
PspN4I	GGNNCC	1 cut(s)	233
PspPI	GGNCC	2 cut(s)	231, 244
RsaI	GTAC	1 cut(s)	250
RsaNI	GTAC	1 cut(s)	249
SaqAI	TTAA	1 cut(s)	17
Sau96I	GGNCC	2 cut(s)	231, 244
SetI	ASST	2 cut(s)	25, 70
SgeI	CNNG	4 cut(s)	47, 57, 68, 212
Sse9I	AATT	3 cut(s)	14, 39, 122
SspMI	CTAG	1 cut(s)	200
TasI	AATT	3 cut(s)	14, 39, 122
Tru1I	TTAA	1 cut(s)	17
Tru9I	TTAA	1 cut(s)	17
TspDTI	ATGAA	2 cut(s)	23, 221
XapI	RAATTY	1 cut(s)	122
XbaI	TCTAGA	1 cut(s)	199
XspI	CTAG	1 cut(s)	200

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.