Rh7BG152500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Reverse (-)
11292606 .. 11293007
402 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG152500.1

Sequence Viewer

Length: 315 bp
ATGCCCTTCATACGTCCTGAATTTCCAACAACTTTTGGTGCTCAAGGCATTCCCTCGCATTATCCTTATGGATTTCCACTAACAACTTCTAGTGTACAAGCGATGCCTAATCAATCACATGGCATTCCCTCCCATTATCCTTATGGATTTCCACCAACATGTTCTATTATTCATGCAATTCCAAGTCAATCACTTGGTTACCAACCTATTCGACCAATGTTTGATTATTCACTTATGTATTCGCAGGCCATCACCCAACCAAGACCTCAAGGACCAGCTCTCCAACTGAATTTTCCAGATCCATCGAAATCGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

104

Amino Acids

11.53

Weight (kDa)

7.94

Isoelectric Point (pI)

73.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 293
AcsI RAATTY 2 cut(s) 20, 289
AfaI GTAC 1 cut(s) 96
AflIII ACRYGT 1 cut(s) 158
AjuI GAANNNNNNNTTGG 2 cut(s) 276, 308
AluBI AGCT 1 cut(s) 278
AluI AGCT 1 cut(s) 278
Alw21I GWGCWC 1 cut(s) 43
AlwI GGATC 1 cut(s) 293
AoxI GGCC 1 cut(s) 246
ApoI RAATTY 2 cut(s) 20, 289
AspS9I GGNCC 1 cut(s) 272
AsuHPI GGTGA 1 cut(s) 244
AvaII GGWCC 1 cut(s) 272
Bbv12I GWGCWC 1 cut(s) 43
BccI CCATC 2 cut(s) 257, 310
BfaI CTAG 1 cut(s) 90
Bme18I GGWCC 1 cut(s) 272
BmgT120I GGNCC 1 cut(s) 272
BmsI GCATC 1 cut(s) 93
BpuEI CTTGAG 2 cut(s) 27, 252
BsaXI ACNNNNNCTCC 2 cut(s) 264, 294
BshFI GGCC 1 cut(s) 248
BsiHKAI GWGCWC 1 cut(s) 43
BsmI GAATGC 2 cut(s) 48, 123
BsnI GGCC 1 cut(s) 248
Bsp1286I GDGCHC 1 cut(s) 43
Bsp1407I TGTACA 1 cut(s) 94
Bsp143I GATC 1 cut(s) 298
BspANI GGCC 1 cut(s) 248
BspPI GGATC 1 cut(s) 293
BsrGI TGTACA 1 cut(s) 94
BssMI GATC 1 cut(s) 298
BstAUI TGTACA 1 cut(s) 94
BstC8I GCNNGC 1 cut(s) 246
BstEII GGTNACC 1 cut(s) 197
BstKTI GATC 1 cut(s) 301
BstMBI GATC 1 cut(s) 298
BstNSI RCATGY 1 cut(s) 162
BstPI GGTNACC 1 cut(s) 197
BstX2I RGATCY 1 cut(s) 298
BstYI RGATCY 1 cut(s) 298
BsuRI GGCC 1 cut(s) 248
BtgZI GCGATG 1 cut(s) 116
Cac8I GCNNGC 1 cut(s) 246
Cfr13I GGNCC 1 cut(s) 272
Csp6I GTAC 1 cut(s) 95
CviAII CATG 3 cut(s) 119, 159, 173
CviJI RGCY 2 cut(s) 248, 278
CviKI_1 RGCY 2 cut(s) 248, 278
CviQI GTAC 1 cut(s) 95
DpnI GATC 1 cut(s) 300
DpnII GATC 1 cut(s) 298
Eco47I GGWCC 1 cut(s) 272
Eco91I GGTNACC 1 cut(s) 197
EcoO65I GGTNACC 1 cut(s) 197
FaeI CATG 3 cut(s) 122, 162, 176
FaiI YATR 7 cut(s) 11, 69, 120, 144, 160, 174, 236
FatI CATG 3 cut(s) 118, 158, 172
FspBI CTAG 1 cut(s) 90
HaeIII GGCC 1 cut(s) 248
Hin1II CATG 3 cut(s) 122, 162, 176
HphI GGTGA 1 cut(s) 244
Hpy166II GTNNAC 1 cut(s) 95
Hpy188III TCNNGA 2 cut(s) 17, 296
Hpy8I GTNNAC 1 cut(s) 95
HpyAV CCTTC 1 cut(s) 16
HpyCH4IV ACGT 1 cut(s) 13
HpyCH4V TGCA 1 cut(s) 176
HpySE526I ACGT 1 cut(s) 13
Hsp92II CATG 3 cut(s) 122, 162, 176
Kzo9I GATC 1 cut(s) 298
LpnPI CCDG 4 cut(s) 30, 230, 288, 309
LweI GCATC 1 cut(s) 93
MaeI CTAG 1 cut(s) 90
MaeII ACGT 1 cut(s) 13
MaeIII GTNAC 1 cut(s) 197
MalI GATC 1 cut(s) 300
MboI GATC 1 cut(s) 298
MflI RGATCY 1 cut(s) 298
MhlI GDGCHC 1 cut(s) 43
MluCI AATT 3 cut(s) 20, 177, 289
MmeI TCCRAC 2 cut(s) 50, 307
MnlI CCTC 3 cut(s) 64, 139, 276
MslI CAYNNNNRTG 1 cut(s) 157
Mva1269I GAATGC 2 cut(s) 48, 123
NdeII GATC 1 cut(s) 298
NlaIII CATG 3 cut(s) 122, 162, 176
NspI RCATGY 1 cut(s) 162
PciI ACATGT 1 cut(s) 158
PctI GAATGC 2 cut(s) 48, 123
PscI ACATGT 1 cut(s) 158
PspEI GGTNACC 1 cut(s) 197
PspPI GGNCC 1 cut(s) 272
PsuI RGATCY 1 cut(s) 298
RsaI GTAC 1 cut(s) 96
RsaNI GTAC 1 cut(s) 95
RseI CAYNNNNRTG 1 cut(s) 157
Sau3AI GATC 1 cut(s) 298
Sau96I GGNCC 1 cut(s) 272
SduI GDGCHC 1 cut(s) 43
SetI ASST 4 cut(s) 16, 208, 268, 280
SfaNI GCATC 1 cut(s) 93
SinI GGWCC 1 cut(s) 272
SmiMI CAYNNNNRTG 1 cut(s) 157
SmlI CTYRAG 2 cut(s) 42, 267
SmoI CTYRAG 2 cut(s) 42, 267
Sse9I AATT 3 cut(s) 20, 177, 289
SspMI CTAG 1 cut(s) 90
TaiI ACGT 1 cut(s) 16
TaqI TCGA 2 cut(s) 211, 305
TasI AATT 3 cut(s) 20, 177, 289
TatI WGTACW 1 cut(s) 94
TspDTI ATGAA 1 cut(s) 161
VpaK11BI GGWCC 1 cut(s) 272
XapI RAATTY 2 cut(s) 20, 289
XceI RCATGY 1 cut(s) 162
XcmI CCANNNNNNNNNTGG 1 cut(s) 140
XspI CTAG 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.