Rh4AG219100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
51667685 .. 51669497
1813 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG219100.1

Sequence Viewer

Length: 207 bp
ATGGATTTGCCTGACCTAACACTTGGACTCAGTTTACCGTGTGTCCAGGATGATCACAACAATGATCATCCTGAAGTTCCACAGCCCTTCAATGCACCTGATGCTTTGAACATTATTCAGGCAACAGAGGTGGCATTGGCCCTTCATTATTTAAAAGATTGCAGAATACCTCCGGAATATGGTCGGCCAACTATGCCTCTTTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.63

Weight (kDa)

4.36

Isoelectric Point (pI)

64.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 172
AcoI YGGCCR 1 cut(s) 185
AcuI CTGAAG 1 cut(s) 93
AfiI CCNNNNNNNGG 1 cut(s) 179
AgsI TTSAA 2 cut(s) 91, 109
AjnI CCWGG 1 cut(s) 45
Aor13HI TCCGGA 1 cut(s) 172
AoxI GGCC 2 cut(s) 138, 185
AspS9I GGNCC 1 cut(s) 139
BciT130I CCWGG 1 cut(s) 47
BclI TGATCA 2 cut(s) 52, 64
Bme1390I CCNGG 1 cut(s) 47
BmgT120I GGNCC 1 cut(s) 139
BmrFI CCNGG 1 cut(s) 47
BmsI GCATC 1 cut(s) 91
BsaWI WCCGGW 1 cut(s) 172
Bsc4I CCNNNNNNNGG 1 cut(s) 179
BseAI TCCGGA 1 cut(s) 172
BseBI CCWGG 1 cut(s) 47
BseGI GGATG 2 cut(s) 55, 67
BseLI CCNNNNNNNGG 1 cut(s) 179
BseMII CTCAG 1 cut(s) 43
BshFI GGCC 2 cut(s) 140, 187
BsiSI CCGG 1 cut(s) 173
BslI CCNNNNNNNGG 1 cut(s) 179
BsnI GGCC 2 cut(s) 140, 187
Bsp13I TCCGGA 1 cut(s) 172
Bsp143I GATC 2 cut(s) 52, 64
BspANI GGCC 2 cut(s) 140, 187
BspCNI CTCAG 1 cut(s) 42
BspEI TCCGGA 1 cut(s) 172
BssMI GATC 2 cut(s) 52, 64
Bst2UI CCWGG 1 cut(s) 47
Bst4CI ACNGT 1 cut(s) 39
BstAPI GCANNNNNTGC 1 cut(s) 101
BstDEI CTNAG 1 cut(s) 29
BstF5I GGATG 2 cut(s) 55, 67
BstKTI GATC 2 cut(s) 55, 67
BstMBI GATC 2 cut(s) 52, 64
BstMWI GCNNNNNNNGC 2 cut(s) 101, 193
BstNI CCWGG 1 cut(s) 47
BstSCI CCNGG 1 cut(s) 45
BsuRI GGCC 2 cut(s) 140, 187
BtsCI GGATG 2 cut(s) 55, 67
Cfr13I GGNCC 1 cut(s) 139
CspCI CAANNNNNGTGG 2 cut(s) 111, 146
CviJI RGCY 3 cut(s) 85, 140, 187
CviKI_1 RGCY 3 cut(s) 85, 140, 187
DdeI CTNAG 1 cut(s) 29
DpnI GATC 2 cut(s) 54, 66
DpnII GATC 2 cut(s) 52, 64
DraI TTTAAA 1 cut(s) 153
EaeI YGGCCR 1 cut(s) 185
Eco57I CTGAAG 1 cut(s) 93
EcoRII CCWGG 1 cut(s) 45
FaiI YATR 2 cut(s) 180, 194
FbaI TGATCA 2 cut(s) 52, 64
FokI GGATG 2 cut(s) 54, 62
HaeIII GGCC 2 cut(s) 140, 187
HapII CCGG 1 cut(s) 173
HinfI GANTC 1 cut(s) 27
HpaII CCGG 1 cut(s) 173
Hpy166II GTNNAC 1 cut(s) 35
Hpy188III TCNNGA 2 cut(s) 71, 173
Hpy8I GTNNAC 1 cut(s) 35
HpyAV CCTTC 2 cut(s) 97, 152
HpyCH4III ACNGT 1 cut(s) 39
HpyCH4V TGCA 2 cut(s) 95, 162
HpyF10VI GCNNNNNNNGC 2 cut(s) 101, 193
HpyF3I CTNAG 1 cut(s) 29
Kpn2I TCCGGA 1 cut(s) 172
Ksp22I TGATCA 2 cut(s) 52, 64
Kzo9I GATC 2 cut(s) 52, 64
LpnPI CCDG 7 cut(s) 24, 32, 59, 84, 104, 111, 186
LweI GCATC 1 cut(s) 91
MalI GATC 2 cut(s) 54, 66
MboI GATC 2 cut(s) 52, 64
MlyI GAGTC 1 cut(s) 21
MnlI CCTC 3 cut(s) 121, 180, 207
MroI TCCGGA 1 cut(s) 172
MseI TTAA 1 cut(s) 152
MslI CAYNNNNRTG 1 cut(s) 60
MspI CCGG 1 cut(s) 173
MspR9I CCNGG 1 cut(s) 47
MvaI CCWGG 1 cut(s) 47
MwoI GCNNNNNNNGC 2 cut(s) 101, 193
NdeII GATC 2 cut(s) 52, 64
PfoI TCCNGGA 1 cut(s) 45
PleI GAGTC 1 cut(s) 21
PpsI GAGTC 1 cut(s) 21
Psp6I CCWGG 1 cut(s) 45
PspGI CCWGG 1 cut(s) 45
PspPI GGNCC 1 cut(s) 139
RseI CAYNNNNRTG 1 cut(s) 60
SaqAI TTAA 1 cut(s) 152
Sau3AI GATC 2 cut(s) 52, 64
Sau96I GGNCC 1 cut(s) 139
SchI GAGTC 1 cut(s) 21
ScrFI CCNGG 1 cut(s) 47
SetI ASST 4 cut(s) 18, 100, 132, 172
SfaNI GCATC 1 cut(s) 91
SgeI CNNG 9 cut(s) 23, 35, 51, 58, 59, 83, 110, 131, 185
SmiMI CAYNNNNRTG 1 cut(s) 60
StyD4I CCNGG 1 cut(s) 45
TaaI ACNGT 1 cut(s) 39
Tru1I TTAA 1 cut(s) 152
Tru9I TTAA 1 cut(s) 152
TspDTI ATGAA 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.