Rh4BG118800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0002107
Physical Location & Seq
Reverse (-)
19897067 .. 19899647
2581 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG118800.1

Sequence Viewer

Length: 438 bp
ATGAATCAAGTTAAGGGTAAAGGAGGAGGAGGAGAAAACATGCTCAAACATATAAATTACGTTGTCAAAAGGAAAAGACAGTCTACAACAGTAAAGCTGGAAAACATGCAGTGGAAGAATTTAGCACTCATTGTTCTGAAAATCGAGGAAAAATGGGACATGGAGGGGCTAGGGAAAGCCGGACAGCTAATCAAAAGATCTAAGCTACGTGGGTTTTTCCTGAATATTCTTGTCAGAGCGTTCTCTGTTGCTGTGGTCTATGATTTGAACAAGATTGGCCTTAAAGCATTTTCAGGAAGTGAAATAATAATGCCATTGCTTGCTTTAAACTCCATGTCCTTGATGAGGATGTTGTCGCTAATGGTGTATTCAAATCAATACTATGAGTGCAAGGAGACTCATGGAGAAGAGCTTGAACTGCAAGGAAGTATGCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

145

Amino Acids

16.53

Weight (kDa)

9.65

Isoelectric Point (pI)

49.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 83
AcsI RAATTY 1 cut(s) 118
AfiI CCNNNNNNNGG 1 cut(s) 345
AgsI TTSAA 3 cut(s) 268, 372, 416
AluBI AGCT 4 cut(s) 97, 187, 205, 412
AluI AGCT 4 cut(s) 97, 187, 205, 412
Alw26I GTCTC 1 cut(s) 389
AoxI GGCC 1 cut(s) 277
ApoI RAATTY 1 cut(s) 118
BcoDI GTCTC 1 cut(s) 389
BfaI CTAG 1 cut(s) 170
BglII AGATCT 1 cut(s) 197
BsaAI YACGTR 1 cut(s) 209
Bsc4I CCNNNNNNNGG 1 cut(s) 345
Bse3DI GCAATG 1 cut(s) 314
BseGI GGATG 1 cut(s) 354
BseLI CCNNNNNNNGG 1 cut(s) 345
BseMI GCAATG 1 cut(s) 314
BseRI GAGGAG 3 cut(s) 39, 42, 45
BshFI GGCC 1 cut(s) 279
BsiSI CCGG 1 cut(s) 180
BslFI GGGAC 1 cut(s) 170
BslI CCNNNNNNNGG 1 cut(s) 345
BsmAI GTCTC 1 cut(s) 389
BsmFI GGGAC 1 cut(s) 170
BsnI GGCC 1 cut(s) 279
Bsp143I GATC 1 cut(s) 197
BspANI GGCC 1 cut(s) 279
BspQI GCTCTTC 1 cut(s) 402
BsrDI GCAATG 1 cut(s) 314
BssMI GATC 1 cut(s) 197
Bst4CI ACNGT 2 cut(s) 81, 91
Bst6I CTCTTC 1 cut(s) 402
BstBAI YACGTR 1 cut(s) 209
BstC8I GCNNGC 1 cut(s) 321
BstDEI CTNAG 1 cut(s) 201
BstENI CCTNNNNNAGG 1 cut(s) 343
BstF5I GGATG 1 cut(s) 354
BstKTI GATC 1 cut(s) 200
BstMAI GTCTC 1 cut(s) 389
BstMBI GATC 1 cut(s) 197
BstMWI GCNNNNNNNGC 1 cut(s) 418
BstNSI RCATGY 2 cut(s) 43, 109
BstX2I RGATCY 1 cut(s) 197
BstYI RGATCY 1 cut(s) 197
BsuRI GGCC 1 cut(s) 279
BtsCI GGATG 1 cut(s) 354
BtsI GCAGTG 1 cut(s) 116
BtsIMutI CAGTG 1 cut(s) 116
Cac8I GCNNGC 1 cut(s) 321
CviAII CATG 5 cut(s) 40, 106, 160, 334, 401
CviJI RGCY 7 cut(s) 97, 169, 179, 187, 205, 279, 412
CviKI_1 RGCY 7 cut(s) 97, 169, 179, 187, 205, 279, 412
DdeI CTNAG 1 cut(s) 201
DpnI GATC 1 cut(s) 199
DpnII GATC 1 cut(s) 197
DraI TTTAAA 1 cut(s) 327
Eam1104I CTCTTC 1 cut(s) 402
EarI CTCTTC 1 cut(s) 402
EcoNI CCTNNNNNAGG 1 cut(s) 343
EcoT22I ATGCAT 1 cut(s) 435
FaeI CATG 5 cut(s) 43, 109, 163, 337, 404
FaqI GGGAC 1 cut(s) 170
FatI CATG 5 cut(s) 39, 105, 159, 333, 400
FblI GTMKAC 1 cut(s) 83
FokI GGATG 1 cut(s) 361
FspBI CTAG 1 cut(s) 170
HaeIII GGCC 1 cut(s) 279
HapII CCGG 1 cut(s) 180
Hin1II CATG 5 cut(s) 43, 109, 163, 337, 404
HinfI GANTC 2 cut(s) 4, 397
HpaII CCGG 1 cut(s) 180
Hpy166II GTNNAC 1 cut(s) 84
Hpy188I TCNGA 2 cut(s) 138, 236
Hpy188III TCNNGA 2 cut(s) 220, 294
Hpy8I GTNNAC 1 cut(s) 84
HpyCH4III ACNGT 2 cut(s) 81, 91
HpyCH4IV ACGT 2 cut(s) 60, 208
HpyCH4V TGCA 4 cut(s) 109, 390, 421, 433
HpyF10VI GCNNNNNNNGC 1 cut(s) 418
HpyF3I CTNAG 1 cut(s) 201
HpySE526I ACGT 2 cut(s) 60, 208
Hsp92II CATG 5 cut(s) 43, 109, 163, 337, 404
Kzo9I GATC 1 cut(s) 197
LguI GCTCTTC 1 cut(s) 402
LpnPI CCDG 4 cut(s) 83, 193, 233, 279
MaeI CTAG 1 cut(s) 170
MaeII ACGT 2 cut(s) 60, 208
MalI GATC 1 cut(s) 199
MboI GATC 1 cut(s) 197
MboII GAAGA 2 cut(s) 127, 419
MflI RGATCY 1 cut(s) 197
MluCI AATT 2 cut(s) 55, 118
MlyI GAGTC 1 cut(s) 391
MnlI CCTC 6 cut(s) 17, 20, 23, 139, 157, 339
Mph1103I ATGCAT 1 cut(s) 435
MseI TTAA 3 cut(s) 12, 282, 326
MspI CCGG 1 cut(s) 180
MwoI GCNNNNNNNGC 1 cut(s) 418
NdeII GATC 1 cut(s) 197
NlaIII CATG 5 cut(s) 43, 109, 163, 337, 404
NsiI ATGCAT 1 cut(s) 435
NspI RCATGY 2 cut(s) 43, 109
PciSI GCTCTTC 1 cut(s) 402
PfeI GAWTC 1 cut(s) 4
PleI GAGTC 1 cut(s) 391
PpsI GAGTC 1 cut(s) 391
Ppu21I YACGTR 1 cut(s) 209
PsuI RGATCY 1 cut(s) 197
SapI GCTCTTC 1 cut(s) 402
SaqAI TTAA 3 cut(s) 12, 282, 326
Sau3AI GATC 1 cut(s) 197
SchI GAGTC 1 cut(s) 391
SetI ASST 6 cut(s) 63, 99, 189, 207, 211, 414
Sse9I AATT 2 cut(s) 55, 118
SspI AATATT 1 cut(s) 226
SspMI CTAG 1 cut(s) 170
TaaI ACNGT 2 cut(s) 81, 91
TaiI ACGT 2 cut(s) 63, 211
TaqI TCGA 1 cut(s) 144
TasI AATT 2 cut(s) 55, 118
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 3 cut(s) 12, 282, 326
Tru9I TTAA 3 cut(s) 12, 282, 326
TscAI CASTG 1 cut(s) 116
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 116
XagI CCTNNNNNAGG 1 cut(s) 343
XapI RAATTY 1 cut(s) 118
XceI RCATGY 2 cut(s) 43, 109
XmiI GTMKAC 1 cut(s) 83
XspI CTAG 1 cut(s) 170
Zsp2I ATGCAT 1 cut(s) 435
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.