Rh4DG117900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Reverse (-)
18668509 .. 18668787
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG117900.1

Sequence Viewer

Length: 279 bp
ATGGAAGGGCTAGGGAAAGCCGGACAGCTAATCAAAAGATCTAAGCTACGTGGGTTTTTCTTGAATATTCTTTTCAGAGCGTTCTCTGTTGCTGTGGTCTATGATTTGAACAAGATTGGCCTTAAAGCATTTCCAGGACGTGAAATAATAATGCCATTGCTTGCTTTAAACTCCATGTCCTTGATGAGGATGTTGTCGCTAATGGTGTATTCAAATCAATACTATGAGTGCAAGGAGAATCATGGAGAAGAGCTTGAACTGCAAGGAAGTATGCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

92

Amino Acids

10.5

Weight (kDa)

9.21

Isoelectric Point (pI)

53.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 186
AgsI TTSAA 4 cut(s) 64, 109, 213, 257
AjiI CACGTC 1 cut(s) 140
AjnI CCWGG 1 cut(s) 133
AluBI AGCT 3 cut(s) 28, 46, 253
AluI AGCT 3 cut(s) 28, 46, 253
AoxI GGCC 1 cut(s) 118
BciT130I CCWGG 1 cut(s) 135
BfaI CTAG 1 cut(s) 11
BglII AGATCT 1 cut(s) 38
Bme1390I CCNGG 1 cut(s) 135
BmgBI CACGTC 1 cut(s) 140
BmrFI CCNGG 1 cut(s) 135
BsaAI YACGTR 1 cut(s) 50
Bsc4I CCNNNNNNNGG 1 cut(s) 186
Bse3DI GCAATG 1 cut(s) 155
BseBI CCWGG 1 cut(s) 135
BseGI GGATG 1 cut(s) 195
BseLI CCNNNNNNNGG 1 cut(s) 186
BseMI GCAATG 1 cut(s) 155
BshFI GGCC 1 cut(s) 120
BsiSI CCGG 1 cut(s) 21
BslI CCNNNNNNNGG 1 cut(s) 186
BsnI GGCC 1 cut(s) 120
Bsp143I GATC 1 cut(s) 38
BspANI GGCC 1 cut(s) 120
BspQI GCTCTTC 1 cut(s) 243
BsrDI GCAATG 1 cut(s) 155
BssMI GATC 1 cut(s) 38
Bst2UI CCWGG 1 cut(s) 135
Bst6I CTCTTC 1 cut(s) 243
BstBAI YACGTR 1 cut(s) 50
BstC8I GCNNGC 1 cut(s) 162
BstDEI CTNAG 1 cut(s) 42
BstENI CCTNNNNNAGG 1 cut(s) 184
BstF5I GGATG 1 cut(s) 195
BstKTI GATC 1 cut(s) 41
BstMBI GATC 1 cut(s) 38
BstMWI GCNNNNNNNGC 1 cut(s) 259
BstNI CCWGG 1 cut(s) 135
BstSCI CCNGG 1 cut(s) 133
BstX2I RGATCY 1 cut(s) 38
BstYI RGATCY 1 cut(s) 38
BsuRI GGCC 1 cut(s) 120
BtrI CACGTC 1 cut(s) 140
BtsCI GGATG 1 cut(s) 195
Cac8I GCNNGC 1 cut(s) 162
CviAII CATG 2 cut(s) 175, 242
CviJI RGCY 6 cut(s) 10, 20, 28, 46, 120, 253
CviKI_1 RGCY 6 cut(s) 10, 20, 28, 46, 120, 253
DdeI CTNAG 1 cut(s) 42
DpnI GATC 1 cut(s) 40
DpnII GATC 1 cut(s) 38
DraI TTTAAA 1 cut(s) 168
Eam1104I CTCTTC 1 cut(s) 243
EarI CTCTTC 1 cut(s) 243
EcoNI CCTNNNNNAGG 1 cut(s) 184
EcoRII CCWGG 1 cut(s) 133
EcoT22I ATGCAT 1 cut(s) 276
FaeI CATG 2 cut(s) 178, 245
FaiI YATR 5 cut(s) 102, 176, 225, 243, 272
FatI CATG 2 cut(s) 174, 241
FokI GGATG 1 cut(s) 202
FspBI CTAG 1 cut(s) 11
HaeIII GGCC 1 cut(s) 120
HapII CCGG 1 cut(s) 21
Hin1II CATG 2 cut(s) 178, 245
HinfI GANTC 1 cut(s) 238
HpaII CCGG 1 cut(s) 21
Hpy188I TCNGA 1 cut(s) 77
Hpy188III TCNNGA 1 cut(s) 61
HpyCH4IV ACGT 2 cut(s) 49, 139
HpyCH4V TGCA 3 cut(s) 231, 262, 274
HpyF10VI GCNNNNNNNGC 1 cut(s) 259
HpyF3I CTNAG 1 cut(s) 42
HpySE526I ACGT 2 cut(s) 49, 139
Hsp92II CATG 2 cut(s) 178, 245
Kzo9I GATC 1 cut(s) 38
LguI GCTCTTC 1 cut(s) 243
LpnPI CCDG 3 cut(s) 34, 120, 147
MaeI CTAG 1 cut(s) 11
MaeII ACGT 2 cut(s) 49, 139
MalI GATC 1 cut(s) 40
MboI GATC 1 cut(s) 38
MboII GAAGA 1 cut(s) 260
MflI RGATCY 1 cut(s) 38
MnlI CCTC 1 cut(s) 180
Mph1103I ATGCAT 1 cut(s) 276
MseI TTAA 2 cut(s) 123, 167
MspI CCGG 1 cut(s) 21
MspR9I CCNGG 1 cut(s) 135
MvaI CCWGG 1 cut(s) 135
MwoI GCNNNNNNNGC 1 cut(s) 259
NdeII GATC 1 cut(s) 38
NlaIII CATG 2 cut(s) 178, 245
NsiI ATGCAT 1 cut(s) 276
PciSI GCTCTTC 1 cut(s) 243
PfeI GAWTC 1 cut(s) 238
PfoI TCCNGGA 1 cut(s) 133
Ppu21I YACGTR 1 cut(s) 50
Psp6I CCWGG 1 cut(s) 133
PspGI CCWGG 1 cut(s) 133
PsuI RGATCY 1 cut(s) 38
SapI GCTCTTC 1 cut(s) 243
SaqAI TTAA 2 cut(s) 123, 167
Sau3AI GATC 1 cut(s) 38
ScrFI CCNGG 1 cut(s) 135
SetI ASST 5 cut(s) 30, 48, 52, 142, 255
SspI AATATT 1 cut(s) 67
SspMI CTAG 1 cut(s) 11
StyD4I CCNGG 1 cut(s) 133
TaiI ACGT 2 cut(s) 52, 142
TfiI GAWTC 1 cut(s) 238
Tru1I TTAA 2 cut(s) 123, 167
Tru9I TTAA 2 cut(s) 123, 167
XagI CCTNNNNNAGG 1 cut(s) 184
XspI CTAG 1 cut(s) 11
Zsp2I ATGCAT 1 cut(s) 276
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.