Rh5DG356700

Histone deacetylase HDT1-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
53046222 .. 53047152
931 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG356700.1

Sequence Viewer

Length: 246 bp
ATGGTAGCTGATAAGGAACTTGTCGCTCAAACCTATGTAGGTAGTGCCTTGGTGCCAGACCAAGGCAATGTGGTGCATTTATCACAGGCTTGTTTAGGTGAGTCAAAGACGGCATCTGACGGTGTTGTAATCTATGGAAAGACCATAGGGAAGATGCTTGTGTTGGGACATCTTATTCCTGGCCAAATCCCTCAGTTGTCATGTGACTTGGTCTTTAATGATGAGTTTGAGCTATGCCACAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.63

Weight (kDa)

4.76

Isoelectric Point (pI)

34.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NPL PF17800 19 - 78 5.4e-08 Nucleoplasmin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 52
AcoI YGGCCR 1 cut(s) 181
AfiI CCNNNNNNNGG 1 cut(s) 62
AjnI CCWGG 1 cut(s) 178
AluBI AGCT 2 cut(s) 8, 232
AluI AGCT 2 cut(s) 8, 232
AoxI GGCC 1 cut(s) 181
AsuHPI GGTGA 1 cut(s) 110
BalI TGGCCA 1 cut(s) 183
BanI GGYRCC 1 cut(s) 52
BceAI ACGGC 1 cut(s) 126
BciT130I CCWGG 1 cut(s) 180
BfaI CTAG 1 cut(s) 244
Bme1390I CCNGG 1 cut(s) 180
BmiI GGNNCC 1 cut(s) 54
BmrFI CCNGG 1 cut(s) 180
BmsI GCATC 2 cut(s) 122, 144
BsaJI CCNNGG 2 cut(s) 48, 61
Bsc4I CCNNNNNNNGG 1 cut(s) 62
Bse3DI GCAATG 1 cut(s) 73
BseBI CCWGG 1 cut(s) 180
BseDI CCNNGG 2 cut(s) 48, 61
BseLI CCNNNNNNNGG 1 cut(s) 62
BseMI GCAATG 1 cut(s) 73
BseMII CTCAG 1 cut(s) 206
BshFI GGCC 1 cut(s) 183
BshNI GGYRCC 1 cut(s) 52
BslFI GGGAC 1 cut(s) 180
BslI CCNNNNNNNGG 1 cut(s) 62
BsmFI GGGAC 1 cut(s) 180
BsnI GGCC 1 cut(s) 183
BspANI GGCC 1 cut(s) 183
BspCNI CTCAG 1 cut(s) 205
BspLI GGNNCC 1 cut(s) 54
BspT107I GGYRCC 1 cut(s) 52
BsrDI GCAATG 1 cut(s) 73
BssECI CCNNGG 2 cut(s) 48, 61
BssT1I CCWWGG 2 cut(s) 48, 61
Bst2UI CCWGG 1 cut(s) 180
Bst4CI ACNGT 1 cut(s) 122
BstDEI CTNAG 1 cut(s) 192
BstNI CCWGG 1 cut(s) 180
BstSCI CCNGG 1 cut(s) 178
BsuRI GGCC 1 cut(s) 183
CviAII CATG 1 cut(s) 201
CviJI RGCY 4 cut(s) 8, 89, 183, 232
CviKI_1 RGCY 4 cut(s) 8, 89, 183, 232
DdeI CTNAG 1 cut(s) 192
EaeI YGGCCR 1 cut(s) 181
Eco130I CCWWGG 2 cut(s) 48, 61
EcoRII CCWGG 1 cut(s) 178
EcoT14I CCWWGG 2 cut(s) 48, 61
ErhI CCWWGG 2 cut(s) 48, 61
FaeI CATG 1 cut(s) 204
FaiI YATR 5 cut(s) 36, 135, 146, 202, 235
FaqI GGGAC 1 cut(s) 180
FatI CATG 1 cut(s) 200
FspBI CTAG 1 cut(s) 244
HaeIII GGCC 1 cut(s) 183
Hin1II CATG 1 cut(s) 204
HinfI GANTC 1 cut(s) 101
HphI GGTGA 1 cut(s) 110
Hpy188I TCNGA 1 cut(s) 118
HpyCH4III ACNGT 1 cut(s) 122
HpyCH4V TGCA 1 cut(s) 76
HpyF3I CTNAG 1 cut(s) 192
Hsp92II CATG 1 cut(s) 204
LpnPI CCDG 4 cut(s) 69, 71, 165, 192
LweI GCATC 2 cut(s) 122, 144
MaeI CTAG 1 cut(s) 244
MaeIII GTNAC 1 cut(s) 203
MboII GAAGA 1 cut(s) 163
MlsI TGGCCA 1 cut(s) 183
MluNI TGGCCA 1 cut(s) 183
MlyI GAGTC 1 cut(s) 110
MnlI CCTC 1 cut(s) 201
Mox20I TGGCCA 1 cut(s) 183
MscI TGGCCA 1 cut(s) 183
MseI TTAA 1 cut(s) 216
Msp20I TGGCCA 1 cut(s) 183
MspR9I CCNGG 1 cut(s) 180
MvaI CCWGG 1 cut(s) 180
NlaIII CATG 1 cut(s) 204
NlaIV GGNNCC 1 cut(s) 54
NmuCI GTSAC 1 cut(s) 203
PflFI GACNNNGTC 1 cut(s) 209
PleI GAGTC 1 cut(s) 109
PpsI GAGTC 1 cut(s) 109
Psp6I CCWGG 1 cut(s) 178
PspGI CCWGG 1 cut(s) 178
PspN4I GGNNCC 1 cut(s) 54
PsyI GACNNNGTC 1 cut(s) 209
SaqAI TTAA 1 cut(s) 216
SchI GAGTC 1 cut(s) 110
ScrFI CCNGG 1 cut(s) 180
SetI ASST 5 cut(s) 10, 35, 43, 100, 234
SfaNI GCATC 2 cut(s) 122, 144
SspMI CTAG 1 cut(s) 244
StyD4I CCNGG 1 cut(s) 178
StyI CCWWGG 2 cut(s) 48, 61
TaaI ACNGT 1 cut(s) 122
Tru1I TTAA 1 cut(s) 216
Tru9I TTAA 1 cut(s) 216
TseFI GTSAC 1 cut(s) 203
Tsp45I GTSAC 1 cut(s) 203
Tth111I GACNNNGTC 1 cut(s) 209
XspI CTAG 1 cut(s) 244
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.