Rh5DG495400

Transcription initiation factor TFIID

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
77698592 .. 77699907
1316 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG495400.1

Sequence Viewer

Length: 207 bp
ATGCAGAGTATTGTCCTTTTATCATCTCTACTTAAGCGTATTGATCGGCTTATGTTTTCTTTAATTTATGTTTTCTTTGGAAATGGATGTACCAGGTTGATGCCTAGCTACAATGGTATCTTGTCAGTCAGCTGTATCAGGTCCCTGACACATATTGCCTTGAAACTTTTGGGATTTGTTCCTCTTGATCGTGTGTTTGAACTGTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.72

Weight (kDa)

9.69

Isoelectric Point (pI)

46.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 91
AflII CTTAAG 1 cut(s) 32
AgsI TTSAA 2 cut(s) 163, 200
AjnI CCWGG 1 cut(s) 92
AluBI AGCT 2 cut(s) 108, 132
AluI AGCT 2 cut(s) 108, 132
AspS9I GGNCC 1 cut(s) 141
AvaII GGWCC 1 cut(s) 141
BaeI ACNNNNGTAYC 2 cut(s) 100, 133
BciT130I CCWGG 1 cut(s) 94
BfaI CTAG 1 cut(s) 105
BfrI CTTAAG 1 cut(s) 32
Bme1390I CCNGG 1 cut(s) 94
Bme18I GGWCC 1 cut(s) 141
BmgT120I GGNCC 1 cut(s) 141
BmiI GGNNCC 1 cut(s) 143
BmrFI CCNGG 1 cut(s) 94
BmsI GCATC 1 cut(s) 90
BseBI CCWGG 1 cut(s) 94
BseGI GGATG 1 cut(s) 92
BslFI GGGAC 1 cut(s) 127
BsmFI GGGAC 1 cut(s) 127
Bsp143I GATC 2 cut(s) 43, 187
BspLI GGNNCC 1 cut(s) 143
BspTI CTTAAG 1 cut(s) 32
BssMI GATC 2 cut(s) 43, 187
Bst2UI CCWGG 1 cut(s) 94
Bst4CI ACNGT 1 cut(s) 204
BstAFI CTTAAG 1 cut(s) 32
BstF5I GGATG 1 cut(s) 92
BstKTI GATC 2 cut(s) 46, 190
BstMBI GATC 2 cut(s) 43, 187
BstNI CCWGG 1 cut(s) 94
BstSCI CCNGG 1 cut(s) 92
BtsCI GGATG 1 cut(s) 92
Cfr13I GGNCC 1 cut(s) 141
CsiI ACCWGGT 1 cut(s) 92
Csp6I GTAC 1 cut(s) 90
CviJI RGCY 3 cut(s) 49, 108, 132
CviKI_1 RGCY 3 cut(s) 49, 108, 132
CviQI GTAC 1 cut(s) 90
DpnI GATC 2 cut(s) 45, 189
DpnII GATC 2 cut(s) 43, 187
Eco47I GGWCC 1 cut(s) 141
EcoO109I RGGNCCY 1 cut(s) 141
EcoRII CCWGG 1 cut(s) 92
FaiI YATR 3 cut(s) 53, 69, 153
FaqI GGGAC 1 cut(s) 127
FokI GGATG 1 cut(s) 99
FspBI CTAG 1 cut(s) 105
Hpy188III TCNNGA 1 cut(s) 185
HpyCH4III ACNGT 1 cut(s) 204
HpyCH4V TGCA 1 cut(s) 4
Kzo9I GATC 2 cut(s) 43, 187
LpnPI CCDG 4 cut(s) 79, 106, 124, 158
LweI GCATC 1 cut(s) 90
MabI ACCWGGT 1 cut(s) 92
MaeI CTAG 1 cut(s) 105
MalI GATC 2 cut(s) 45, 189
MboI GATC 2 cut(s) 43, 187
MluCI AATT 1 cut(s) 63
MnlI CCTC 1 cut(s) 192
MseI TTAA 2 cut(s) 33, 62
MspA1I CMGCKG 1 cut(s) 132
MspCI CTTAAG 1 cut(s) 32
MspR9I CCNGG 1 cut(s) 94
MvaI CCWGG 1 cut(s) 94
NdeII GATC 2 cut(s) 43, 187
NlaIV GGNNCC 1 cut(s) 143
PpuMI RGGWCCY 1 cut(s) 141
Psp5II RGGWCCY 1 cut(s) 141
Psp6I CCWGG 1 cut(s) 92
PspGI CCWGG 1 cut(s) 92
PspN4I GGNNCC 1 cut(s) 143
PspPI GGNCC 1 cut(s) 141
PspPPI RGGWCCY 1 cut(s) 141
PvuII CAGCTG 1 cut(s) 132
RsaI GTAC 1 cut(s) 91
RsaNI GTAC 1 cut(s) 90
SaqAI TTAA 2 cut(s) 33, 62
Sau3AI GATC 2 cut(s) 43, 187
Sau96I GGNCC 1 cut(s) 141
ScrFI CCNGG 1 cut(s) 94
SetI ASST 4 cut(s) 98, 110, 134, 143
SexAI ACCWGGT 1 cut(s) 92
SfaNI GCATC 1 cut(s) 90
SgeI CNNG 9 cut(s) 105, 106, 117, 133, 151, 157, 172, 197, 203
SinI GGWCC 1 cut(s) 141
SmlI CTYRAG 1 cut(s) 32
SmoI CTYRAG 1 cut(s) 32
Sse9I AATT 1 cut(s) 63
SspMI CTAG 1 cut(s) 105
StyD4I CCNGG 1 cut(s) 92
TaaI ACNGT 1 cut(s) 204
TasI AATT 1 cut(s) 63
Tru1I TTAA 2 cut(s) 33, 62
Tru9I TTAA 2 cut(s) 33, 62
Vha464I CTTAAG 1 cut(s) 32
VpaK11BI GGWCC 1 cut(s) 141
XspI CTAG 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.