Rh7BG189600

Transcription initiation factor TFIID

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
15299358 .. 15301380
2023 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG189600.1

Sequence Viewer

Length: 195 bp
ATGCTTTTCATATGTGATTTGCTTGAATTGAGATTTCACTTTTGTGTTGAGAATATTAATCAGTTGGAGGAGGACAGAGATGTTGTTGCTCAGGCACAAGCAATTGCAATGCTTGAATCCTTACCTCAGCTTCCATTTTCTGTTGTTAATGCTCTGCATAACTTTCTCATTGACTCCAAGGCAGTTGGAAATTAA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.24

Weight (kDa)

4.39

Isoelectric Point (pI)

42.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 26, 116
AleI CACNNNNGTG 1 cut(s) 42
AluBI AGCT 1 cut(s) 130
AluI AGCT 1 cut(s) 130
AseI ATTAAT 1 cut(s) 57
BbvCI CCTCAGC 1 cut(s) 126
Bpu10I CCTNAGC 2 cut(s) 90, 126
BsaJI CCNNGG 1 cut(s) 177
Bse3DI GCAATG 1 cut(s) 114
BseDI CCNNGG 1 cut(s) 177
BseMI GCAATG 1 cut(s) 114
BseMII CTCAG 2 cut(s) 104, 140
BseRI GAGGAG 1 cut(s) 83
BspCNI CTCAG 2 cut(s) 103, 139
BsrDI GCAATG 1 cut(s) 114
BssECI CCNNGG 1 cut(s) 177
BssT1I CCWWGG 1 cut(s) 177
BstDEI CTNAG 2 cut(s) 90, 126
CviJI RGCY 1 cut(s) 130
CviKI_1 RGCY 1 cut(s) 130
DdeI CTNAG 2 cut(s) 90, 126
Eco130I CCWWGG 1 cut(s) 177
EcoT14I CCWWGG 1 cut(s) 177
ErhI CCWWGG 1 cut(s) 177
FaiI YATR 3 cut(s) 11, 13, 159
FauNDI CATATG 1 cut(s) 11
HinfI GANTC 2 cut(s) 116, 173
HpyCH4V TGCA 2 cut(s) 107, 157
HpyF3I CTNAG 2 cut(s) 90, 126
LpnPI CCDG 1 cut(s) 77
MfeI CAATTG 1 cut(s) 102
MluCI AATT 3 cut(s) 26, 102, 190
MlyI GAGTC 1 cut(s) 167
MmeI TCCRAC 2 cut(s) 45, 166
MnlI CCTC 3 cut(s) 61, 64, 135
MseI TTAA 3 cut(s) 57, 147, 193
MslI CAYNNNNRTG 1 cut(s) 42
MunI CAATTG 1 cut(s) 102
NdeI CATATG 1 cut(s) 11
OliI CACNNNNGTG 1 cut(s) 42
PfeI GAWTC 1 cut(s) 116
PleI GAGTC 1 cut(s) 167
PpsI GAGTC 1 cut(s) 167
PshBI ATTAAT 1 cut(s) 57
RseI CAYNNNNRTG 1 cut(s) 42
SaqAI TTAA 3 cut(s) 57, 147, 193
SchI GAGTC 1 cut(s) 167
SetI ASST 2 cut(s) 127, 132
SgeI CNNG 5 cut(s) 35, 104, 110, 125, 190
SmiMI CAYNNNNRTG 1 cut(s) 42
Sse9I AATT 3 cut(s) 26, 102, 190
SspI AATATT 1 cut(s) 55
StyI CCWWGG 1 cut(s) 177
TasI AATT 3 cut(s) 26, 102, 190
TfiI GAWTC 1 cut(s) 116
Tru1I TTAA 3 cut(s) 57, 147, 193
Tru9I TTAA 3 cut(s) 57, 147, 193
VspI ATTAAT 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.