Rh7BG265600

Isoflavone reductase homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
OG0001108
Physical Location & Seq
Reverse (-)
24283863 .. 24284546
684 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG265600.1

Sequence Viewer

Length: 360 bp
ATGGACGAAGATGACATCGGAAGCTATACAATCAAGACACTAGATGATCCGCGAACTTTGAACAAAACATTGTATCTTCTTCCGCCCGAAAACCTACTCACTCAAAGACAATTGGTGGACATTTGGGAAAATCTTGTTGGAAAGAAACTAGAGAAAATTTCTCTTTCTAAAGAAGACCTCCTTGCCTCTATGAAAGGTATGGACTATGCAGGCCAGGTCGGGGTGGGGCATTTCTATCACATTTTCTATGAAGGCTCTTTGACAAATTTCGAAATAGGGGAGGAAGGAGAAGAAGCTTCAAAGCTTTATCCAGAAGTGAAATACACCCGCATGGATGAATACTTGAAAATTTATGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NmrA

Protein Analysis

119

Amino Acids

13.73

Weight (kDa)

4.63

Isoelectric Point (pI)

27.26

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NmrA PF05368 1 - 115 1.8e-17 NmrA-like family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 52
AciI CCGC 3 cut(s) 50, 83, 328
AclWI GGATC 1 cut(s) 41
AcsI RAATTY 3 cut(s) 156, 265, 348
AfiI CCNNNNNNNGG 1 cut(s) 220
AgsI TTSAA 3 cut(s) 61, 300, 346
AjnI CCWGG 1 cut(s) 213
AjuI GAANNNNNNNTTGG 2 cut(s) 120, 152
AluBI AGCT 3 cut(s) 24, 296, 304
AluI AGCT 3 cut(s) 24, 296, 304
AlwI GGATC 1 cut(s) 41
AoxI GGCC 1 cut(s) 211
ApoI RAATTY 3 cut(s) 156, 265, 348
AsuII TTCGAA 1 cut(s) 270
BbsI GAAGAC 1 cut(s) 180
BciT130I CCWGG 1 cut(s) 215
BfaI CTAG 2 cut(s) 41, 149
Bme1390I CCNGG 1 cut(s) 215
BmrFI CCNGG 1 cut(s) 215
BpiI GAAGAC 1 cut(s) 180
Bpu14I TTCGAA 1 cut(s) 270
Bsc4I CCNNNNNNNGG 1 cut(s) 220
BseBI CCWGG 1 cut(s) 215
BseGI GGATG 1 cut(s) 340
BseLI CCNNNNNNNGG 1 cut(s) 220
Bsh1236I CGCG 1 cut(s) 52
BshFI GGCC 1 cut(s) 213
BslI CCNNNNNNNGG 1 cut(s) 220
BsnI GGCC 1 cut(s) 213
Bsp119I TTCGAA 1 cut(s) 270
Bsp143I GATC 1 cut(s) 46
BspACI CCGC 3 cut(s) 50, 83, 328
BspANI GGCC 1 cut(s) 213
BspFNI CGCG 1 cut(s) 52
BspPI GGATC 1 cut(s) 41
BspT104I TTCGAA 1 cut(s) 270
BssMI GATC 1 cut(s) 46
Bst2UI CCWGG 1 cut(s) 215
BstBI TTCGAA 1 cut(s) 270
BstC8I GCNNGC 1 cut(s) 211
BstF5I GGATG 1 cut(s) 340
BstFNI CGCG 1 cut(s) 52
BstKTI GATC 1 cut(s) 49
BstMBI GATC 1 cut(s) 46
BstNI CCWGG 1 cut(s) 215
BstSCI CCNGG 1 cut(s) 213
BstUI CGCG 1 cut(s) 52
BstV2I GAAGAC 1 cut(s) 180
BsuRI GGCC 1 cut(s) 213
BtsCI GGATG 1 cut(s) 340
Cac8I GCNNGC 1 cut(s) 211
CviAII CATG 1 cut(s) 331
CviJI RGCY 5 cut(s) 24, 213, 255, 296, 304
CviKI_1 RGCY 5 cut(s) 24, 213, 255, 296, 304
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
EciI GGCGGA 1 cut(s) 72
EcoRII CCWGG 1 cut(s) 213
EcoT22I ATGCAT 1 cut(s) 358
FaeI CATG 1 cut(s) 334
FaiI YATR 8 cut(s) 27, 191, 200, 207, 249, 332, 354, 358
FalI AAGNNNNNCTT 2 cut(s) 165, 197
FatI CATG 1 cut(s) 330
FauI CCCGC 1 cut(s) 335
FokI GGATG 1 cut(s) 347
FspBI CTAG 2 cut(s) 41, 149
HaeIII GGCC 1 cut(s) 213
Hin1II CATG 1 cut(s) 334
HindIII AAGCTT 2 cut(s) 294, 302
Hpy166II GTNNAC 1 cut(s) 118
Hpy188I TCNGA 1 cut(s) 20
Hpy188III TCNNGA 2 cut(s) 34, 311
Hpy8I GTNNAC 1 cut(s) 118
HpyAV CCTTC 2 cut(s) 245, 278
HpyCH4V TGCA 2 cut(s) 209, 356
Hsp92II CATG 1 cut(s) 334
Kzo9I GATC 1 cut(s) 46
LpnPI CCDG 4 cut(s) 195, 200, 227, 324
MaeI CTAG 2 cut(s) 41, 149
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MboII GAAGA 5 cut(s) 20, 68, 71, 185, 302
MfeI CAATTG 1 cut(s) 110
MluCI AATT 4 cut(s) 110, 156, 265, 348
MmeI TCCRAC 1 cut(s) 118
MnlI CCTC 3 cut(s) 188, 196, 274
Mph1103I ATGCAT 1 cut(s) 358
MslI CAYNNNNRTG 1 cut(s) 329
MspR9I CCNGG 1 cut(s) 215
MunI CAATTG 1 cut(s) 110
MvaI CCWGG 1 cut(s) 215
MvnI CGCG 1 cut(s) 52
NdeII GATC 1 cut(s) 46
NlaIII CATG 1 cut(s) 334
NsiI ATGCAT 1 cut(s) 358
NspV TTCGAA 1 cut(s) 270
Psp6I CCWGG 1 cut(s) 213
PspGI CCWGG 1 cut(s) 213
RseI CAYNNNNRTG 1 cut(s) 329
Sau3AI GATC 1 cut(s) 46
ScrFI CCNGG 1 cut(s) 215
SetI ASST 7 cut(s) 26, 96, 180, 199, 219, 298, 306
SfuI TTCGAA 1 cut(s) 270
SmiMI CAYNNNNRTG 1 cut(s) 329
Sse9I AATT 4 cut(s) 110, 156, 265, 348
SsiI CCGC 3 cut(s) 50, 83, 328
SspMI CTAG 2 cut(s) 41, 149
StyD4I CCNGG 1 cut(s) 213
TaqI TCGA 1 cut(s) 270
TasI AATT 4 cut(s) 110, 156, 265, 348
TspDTI ATGAA 3 cut(s) 206, 264, 351
XapI RAATTY 3 cut(s) 156, 265, 348
XspI CTAG 2 cut(s) 41, 149
Zsp2I ATGCAT 1 cut(s) 358
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.