MD08G1151100.v1.1

Transcription factor

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
Physical Location & Seq
Forward (+)
15430867 .. 15431028
162 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1151100.v1.1.491

Sequence Viewer

Length: 162 bp
ATGGAAGCCAAGGATGGTAGTGAGTATAAGAATGTCGGAGAGATATATGCTGATGTGAGGCTGGTTTTCAAGAATGCAATGAAATATAATGATGAAGGTGAAGATGTCTATGTGATGGCCCAATCGTTGTTGCAAAATTTCGAAGAAAAAAAAAATGGCTAA

Protein Analysis

54

Amino Acids

6.11

Weight (kDa)

4.58

Isoelectric Point (pI)

32.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Bromodomain PF00439 7 - 41 1.9e-09 Bromodomain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 136
AgsI TTSAA 1 cut(s) 70
AoxI GGCC 1 cut(s) 117
ApoI RAATTY 1 cut(s) 136
AspS9I GGNCC 1 cut(s) 118
AsuHPI GGTGA 1 cut(s) 110
AsuII TTCGAA 1 cut(s) 141
BccI CCATC 2 cut(s) 8, 109
BmgT120I GGNCC 1 cut(s) 118
Bpu14I TTCGAA 1 cut(s) 141
BsaJI CCNNGG 1 cut(s) 9
Bse3DI GCAATG 1 cut(s) 84
BseDI CCNNGG 1 cut(s) 9
BseGI GGATG 1 cut(s) 19
BseMI GCAATG 1 cut(s) 84
BshFI GGCC 1 cut(s) 119
BsmI GAATGC 1 cut(s) 79
BsnI GGCC 1 cut(s) 119
Bsp119I TTCGAA 1 cut(s) 141
BspANI GGCC 1 cut(s) 119
BspT104I TTCGAA 1 cut(s) 141
BspTNI GGTCTC 1 cut(s) 1528
BsrDI GCAATG 1 cut(s) 84
BssECI CCNNGG 1 cut(s) 9
BssT1I CCWWGG 1 cut(s) 9
BstBI TTCGAA 1 cut(s) 141
BstF5I GGATG 1 cut(s) 19
BsuRI GGCC 1 cut(s) 119
BtsCI GGATG 1 cut(s) 19
Cfr13I GGNCC 1 cut(s) 118
CviJI RGCY 4 cut(s) 8, 61, 119, 159
CviKI_1 RGCY 4 cut(s) 8, 61, 119, 159
Eco130I CCWWGG 1 cut(s) 9
EcoT14I CCWWGG 1 cut(s) 9
ErhI CCWWGG 1 cut(s) 9
FaiI YATR 5 cut(s) 27, 46, 48, 87, 111
FokI GGATG 1 cut(s) 26
FspEI CC 9 cut(s) 21, 22, 43, 47, 81, 101, 133, 134, 141
HaeIII GGCC 1 cut(s) 119
HphI GGTGA 1 cut(s) 110
Hpy188I TCNGA 1 cut(s) 38
Hpy188III TCNNGA 1 cut(s) 70
HpyAV CCTTC 1 cut(s) 89
HpyCH4V TGCA 2 cut(s) 77, 133
LpnPI CCDG 1 cut(s) 47
MboII GAAGA 2 cut(s) 113, 155
MluCI AATT 1 cut(s) 136
MmeI TCCRAC 1 cut(s) 16
MnlI CCTC 1 cut(s) 51
Mva1269I GAATGC 1 cut(s) 79
NspV TTCGAA 1 cut(s) 141
PctI GAATGC 1 cut(s) 79
PspPI GGNCC 1 cut(s) 118
Sau96I GGNCC 1 cut(s) 118
SetI ASST 1 cut(s) 100
SfuI TTCGAA 1 cut(s) 141
SgeI CNNG 3 cut(s) 22, 74, 82
Sse9I AATT 1 cut(s) 136
StyI CCWWGG 1 cut(s) 9
TaqI TCGA 1 cut(s) 141
TasI AATT 1 cut(s) 136
TspDTI ATGAA 2 cut(s) 95, 108
XapI RAATTY 1 cut(s) 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.