Rmu_sc0012801.1_g000001

Transcription factor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012801.1
Physical Location & Seq
Reverse (-)
1 .. 1789
1789 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012801.1_g000001.1.cds

Sequence Viewer

Length: 346 bp
atgagttcatcaaacccagattctagaagcgttggtgcggctgaagtggagggttttcgggattctgtcaatgaaatttcagcaaaagttaatacgcttgagaaaagagtgaaagaggtcgagcactattacttgaggaaaggcagtctgcaaccaaccacttcgagggagaaagacagggataaacactttaacaccattaagaagcatcaacaagatgcagcacgtagggaagccgctgctgcaaagagaatgcgagatctgttgaataagttttccgcaatctttaaacagatcactcagcacaagtggtcatggccctttatgtcgcctgtagatgttgaaa

Protein Analysis

115

Amino Acids

13.31

Weight (kDa)

9.74

Isoelectric Point (pI)

58.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 38, 237, 279
AcsI RAATTY 1 cut(s) 75
AcuI CTGAAG 1 cut(s) 63
AfiI CCNNNNNNNGG 1 cut(s) 165
AgsI TTSAA 2 cut(s) 268, 344
Alw21I GWGCWC 1 cut(s) 126
AoxI GGCC 1 cut(s) 317
ApeKI GCWGC 3 cut(s) 221, 239, 242
ApoI RAATTY 1 cut(s) 75
AspS9I GGNCC 1 cut(s) 318
Bbv12I GWGCWC 1 cut(s) 126
BbvI GCAGC 3 cut(s) 226, 229, 233
BfaI CTAG 1 cut(s) 24
BfmI CTRYAG 1 cut(s) 333
BglII AGATCT 1 cut(s) 259
BisI GCNGC 5 cut(s) 39, 222, 237, 240, 243
BlsI GCNGC 5 cut(s) 40, 223, 238, 241, 244
BmgT120I GGNCC 1 cut(s) 318
BmsI GCATC 2 cut(s) 208, 217
BpuEI CTTGAG 2 cut(s) 119, 154
BsaAI YACGTR 1 cut(s) 227
Bsc4I CCNNNNNNNGG 1 cut(s) 165
BseLI CCNNNNNNNGG 1 cut(s) 165
BseMII CTCAG 1 cut(s) 314
BseXI GCAGC 3 cut(s) 226, 229, 233
BshFI GGCC 1 cut(s) 319
BsiHKAI GWGCWC 1 cut(s) 126
BslI CCNNNNNNNGG 1 cut(s) 165
BsmI GAATGC 1 cut(s) 258
BsnI GGCC 1 cut(s) 319
Bsp1286I GDGCHC 1 cut(s) 126
Bsp143I GATC 2 cut(s) 259, 294
BspACI CCGC 3 cut(s) 38, 237, 279
BspANI GGCC 1 cut(s) 319
BspCNI CTCAG 1 cut(s) 313
BssMI GATC 2 cut(s) 259, 294
BstBAI YACGTR 1 cut(s) 227
BstDEI CTNAG 1 cut(s) 300
BstKTI GATC 2 cut(s) 262, 297
BstMBI GATC 2 cut(s) 259, 294
BstMWI GCNNNNNNNGC 1 cut(s) 242
BstSFI CTRYAG 1 cut(s) 333
BstV1I GCAGC 3 cut(s) 226, 229, 233
BstX2I RGATCY 1 cut(s) 259
BstYI RGATCY 1 cut(s) 259
BsuRI GGCC 1 cut(s) 319
Cfr13I GGNCC 1 cut(s) 318
CviAII CATG 1 cut(s) 315
CviJI RGCY 3 cut(s) 41, 236, 319
CviKI_1 RGCY 3 cut(s) 41, 236, 319
DdeI CTNAG 1 cut(s) 300
DpnI GATC 2 cut(s) 261, 296
DpnII GATC 2 cut(s) 259, 294
DraI TTTAAA 1 cut(s) 289
Eco57I CTGAAG 1 cut(s) 63
FaeI CATG 1 cut(s) 318
FaiI YATR 2 cut(s) 316, 326
FatI CATG 1 cut(s) 314
Fnu4HI GCNGC 5 cut(s) 39, 222, 237, 240, 243
Fsp4HI GCNGC 5 cut(s) 39, 222, 237, 240, 243
FspBI CTAG 1 cut(s) 24
GluI GCNGC 5 cut(s) 39, 222, 237, 240, 243
HaeIII GGCC 1 cut(s) 319
Hin1II CATG 1 cut(s) 318
HinfI GANTC 2 cut(s) 20, 62
Hpy188III TCNNGA 2 cut(s) 24, 59
HpyCH4IV ACGT 1 cut(s) 226
HpyCH4V TGCA 3 cut(s) 151, 221, 245
HpyF10VI GCNNNNNNNGC 1 cut(s) 242
HpyF3I CTNAG 1 cut(s) 300
HpySE526I ACGT 1 cut(s) 226
Hsp92II CATG 1 cut(s) 318
Kzo9I GATC 2 cut(s) 259, 294
LpnPI CCDG 2 cut(s) 30, 163
Lsp1109I GCAGC 3 cut(s) 226, 229, 233
LweI GCATC 2 cut(s) 208, 217
MaeI CTAG 1 cut(s) 24
MaeII ACGT 1 cut(s) 226
MalI GATC 2 cut(s) 261, 296
MboI GATC 2 cut(s) 259, 294
MflI RGATCY 1 cut(s) 259
MhlI GDGCHC 1 cut(s) 126
MluCI AATT 1 cut(s) 75
MnlI CCTC 4 cut(s) 43, 109, 129, 159
MseI TTAA 4 cut(s) 90, 192, 201, 288
MspA1I CMGCKG 1 cut(s) 239
Mva1269I GAATGC 1 cut(s) 258
MwoI GCNNNNNNNGC 1 cut(s) 242
NdeII GATC 2 cut(s) 259, 294
NlaIII CATG 1 cut(s) 318
PctI GAATGC 1 cut(s) 258
PfeI GAWTC 2 cut(s) 20, 62
PkrI GCNGC 5 cut(s) 40, 223, 238, 241, 244
Ppu21I YACGTR 1 cut(s) 227
PspPI GGNCC 1 cut(s) 318
PsuI RGATCY 1 cut(s) 259
SaqAI TTAA 4 cut(s) 90, 192, 201, 288
SatI GCNGC 5 cut(s) 39, 222, 237, 240, 243
Sau3AI GATC 2 cut(s) 259, 294
Sau96I GGNCC 1 cut(s) 318
SduI GDGCHC 1 cut(s) 126
SetI ASST 2 cut(s) 120, 229
SfaNI GCATC 2 cut(s) 208, 217
SfcI CTRYAG 1 cut(s) 333
SmlI CTYRAG 2 cut(s) 98, 133
SmoI CTYRAG 2 cut(s) 98, 133
Sse9I AATT 1 cut(s) 75
SsiI CCGC 3 cut(s) 38, 237, 279
SspMI CTAG 1 cut(s) 24
TaiI ACGT 1 cut(s) 229
TaqI TCGA 2 cut(s) 120, 164
TasI AATT 1 cut(s) 75
TauI GCSGC 2 cut(s) 41, 239
TfiI GAWTC 2 cut(s) 20, 62
Tru1I TTAA 4 cut(s) 90, 192, 201, 288
Tru9I TTAA 4 cut(s) 90, 192, 201, 288
TseI GCWGC 3 cut(s) 221, 239, 242
TspDTI ATGAA 1 cut(s) 87
XapI RAATTY 1 cut(s) 75
XbaI TCTAGA 1 cut(s) 23
XspI CTAG 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.