MD11G1105200.v1.1

Beta-galactosidase

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Reverse (-)
8973461 .. 8974748
1288 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1105200.v1.1.491

Sequence Viewer

Length: 234 bp
ATGGAACTTCGGGGGATTCCCAGTTTGGCTGAAATATGTCTCCGGAATTGTTTTTCGAAGGACAATGAGCCTTTCAAGGCAGAGAAGCTGTTTCAAACTCAAGGAGGTCCTATAATTCTTTCTCAGAAAGATGATTATAATTTAGTTGCTCCAAAGATAAAACATGGATTTGTTTATGAGATTTCACATTTCTATACGGGCAAAGTAAAACATCACACAAAATTGTCCTACTAG

Protein Analysis

78

Amino Acids

8.87

Weight (kDa)

8.95

Isoelectric Point (pI)

24.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 138
AccIII TCCGGA 1 cut(s) 42
AgsI TTSAA 2 cut(s) 76, 95
AluBI AGCT 1 cut(s) 88
AluI AGCT 1 cut(s) 88
Alw26I GTCTC 1 cut(s) 44
Aor13HI TCCGGA 1 cut(s) 42
AspS9I GGNCC 1 cut(s) 107
AsuII TTCGAA 1 cut(s) 56
AvaII GGWCC 1 cut(s) 107
BcoDI GTCTC 1 cut(s) 44
BfaI CTAG 1 cut(s) 232
Bme18I GGWCC 1 cut(s) 107
BmgT120I GGNCC 1 cut(s) 107
BmrI ACTGGG 1 cut(s) 15
BmuI ACTGGG 1 cut(s) 15
Bpu14I TTCGAA 1 cut(s) 56
BpuEI CTTGAG 1 cut(s) 84
BsaWI WCCGGW 1 cut(s) 42
Bse1I ACTGG 1 cut(s) 21
BseAI TCCGGA 1 cut(s) 42
BseMII CTCAG 1 cut(s) 137
BseNI ACTGG 1 cut(s) 21
BsiSI CCGG 1 cut(s) 43
BsmAI GTCTC 1 cut(s) 44
Bsp119I TTCGAA 1 cut(s) 56
Bsp13I TCCGGA 1 cut(s) 42
BspCNI CTCAG 1 cut(s) 136
BspEI TCCGGA 1 cut(s) 42
BspT104I TTCGAA 1 cut(s) 56
BsrI ACTGG 1 cut(s) 21
BstBI TTCGAA 1 cut(s) 56
BstDEI CTNAG 1 cut(s) 123
BstMAI GTCTC 1 cut(s) 44
Cfr13I GGNCC 1 cut(s) 107
CviAII CATG 1 cut(s) 164
CviJI RGCY 3 cut(s) 29, 70, 88
CviKI_1 RGCY 3 cut(s) 29, 70, 88
DdeI CTNAG 1 cut(s) 123
Eco47I GGWCC 1 cut(s) 107
EcoO109I RGGNCCY 1 cut(s) 107
FaeI CATG 1 cut(s) 167
FaiI YATR 6 cut(s) 37, 113, 138, 165, 177, 195
FatI CATG 1 cut(s) 163
FspBI CTAG 1 cut(s) 232
HapII CCGG 1 cut(s) 43
Hin1II CATG 1 cut(s) 167
HinfI GANTC 1 cut(s) 16
HpaII CCGG 1 cut(s) 43
Hpy188I TCNGA 1 cut(s) 126
Hpy188III TCNNGA 1 cut(s) 43
HpyAV CCTTC 1 cut(s) 52
HpyF3I CTNAG 1 cut(s) 123
Hsp92II CATG 1 cut(s) 167
Kpn2I TCCGGA 1 cut(s) 42
LmnI GCTCC 1 cut(s) 154
LpnPI CCDG 2 cut(s) 34, 56
MaeI CTAG 1 cut(s) 232
MluCI AATT 4 cut(s) 46, 114, 139, 221
MnlI CCTC 1 cut(s) 98
MroI TCCGGA 1 cut(s) 42
MspI CCGG 1 cut(s) 43
NlaIII CATG 1 cut(s) 167
NspV TTCGAA 1 cut(s) 56
PfeI GAWTC 1 cut(s) 16
PpuMI RGGWCCY 1 cut(s) 107
PsiI TTATAA 1 cut(s) 138
Psp5II RGGWCCY 1 cut(s) 107
PspPI GGNCC 1 cut(s) 107
PspPPI RGGWCCY 1 cut(s) 107
Sau96I GGNCC 1 cut(s) 107
SetI ASST 2 cut(s) 90, 109
SfuI TTCGAA 1 cut(s) 56
SgeI CNNG 7 cut(s) 23, 33, 55, 88, 113, 176, 210
SinI GGWCC 1 cut(s) 107
SmlI CTYRAG 1 cut(s) 99
SmoI CTYRAG 1 cut(s) 99
Sse9I AATT 4 cut(s) 46, 114, 139, 221
SspMI CTAG 1 cut(s) 232
TaqI TCGA 1 cut(s) 56
TasI AATT 4 cut(s) 46, 114, 139, 221
TfiI GAWTC 1 cut(s) 16
VpaK11BI GGWCC 1 cut(s) 107
XspI CTAG 1 cut(s) 232
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.